Incidental Mutation 'R0766:Esd'
ID69516
Institutional Source Beutler Lab
Gene Symbol Esd
Ensembl Gene ENSMUSG00000021996
Gene Nameesterase D/formylglutathione hydrolase
SynonymsEs10, Es-10, Esd
MMRRC Submission 038946-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R0766 (G1)
Quality Score210
Status Validated
Chromosome14
Chromosomal Location74732297-74750765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74742121 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 122 (S122P)
Ref Sequence ENSEMBL: ENSMUSP00000135035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022573] [ENSMUST00000175712] [ENSMUST00000175887] [ENSMUST00000176957] [ENSMUST00000177137] [ENSMUST00000177181] [ENSMUST00000177283]
Predicted Effect probably damaging
Transcript: ENSMUST00000022573
AA Change: S122P

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022573
Gene: ENSMUSG00000021996
AA Change: S122P

DomainStartEndE-ValueType
Pfam:Esterase 23 275 8.1e-74 PFAM
Pfam:Chlorophyllase2 29 184 2.7e-8 PFAM
Pfam:Esterase_phd 30 231 1e-7 PFAM
Pfam:Abhydrolase_5 48 261 4.6e-9 PFAM
Pfam:Peptidase_S9 102 282 2.2e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175712
AA Change: S122P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134932
Gene: ENSMUSG00000021996
AA Change: S122P

DomainStartEndE-ValueType
Pfam:Esterase 23 131 4.5e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000175887
AA Change: S122P

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135244
Gene: ENSMUSG00000021996
AA Change: S122P

DomainStartEndE-ValueType
Pfam:Esterase 23 242 1.3e-57 PFAM
Pfam:Chlorophyllase2 29 186 2.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176484
Predicted Effect unknown
Transcript: ENSMUST00000176726
AA Change: S73P
Predicted Effect probably benign
Transcript: ENSMUST00000176957
AA Change: S135P

PolyPhen 2 Score 0.214 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135394
Gene: ENSMUSG00000021996
AA Change: S135P

DomainStartEndE-ValueType
Pfam:AXE1 26 198 1e-7 PFAM
Pfam:Esterase 36 288 6.6e-74 PFAM
Pfam:Abhydrolase_5 61 274 7.1e-9 PFAM
Pfam:Peptidase_S9 116 295 2.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177137
AA Change: S122P

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135818
Gene: ENSMUSG00000021996
AA Change: S122P

DomainStartEndE-ValueType
Pfam:Esterase 23 259 1.4e-68 PFAM
Pfam:Chlorophyllase2 29 184 2.2e-8 PFAM
Pfam:Esterase_phd 30 231 7.9e-8 PFAM
Pfam:Abhydrolase_5 48 247 5.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177181
AA Change: S122P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135035
Gene: ENSMUSG00000021996
AA Change: S122P

DomainStartEndE-ValueType
Pfam:Esterase 23 261 2e-68 PFAM
Pfam:Chlorophyllase2 29 184 2.3e-8 PFAM
Pfam:Esterase_phd 30 231 8.4e-8 PFAM
Pfam:Abhydrolase_5 48 248 5.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177283
AA Change: S122P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135063
Gene: ENSMUSG00000021996
AA Change: S122P

DomainStartEndE-ValueType
Pfam:AXE1 16 185 1.1e-7 PFAM
Pfam:Esterase 23 247 1e-67 PFAM
Pfam:Chlorophyllase2 29 184 1.9e-8 PFAM
Pfam:Esterase_phd 30 231 2.5e-8 PFAM
Pfam:Abhydrolase_5 48 239 5.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177445
Meta Mutation Damage Score 0.6188 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.4%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A T 4: 103,270,797 F44I probably damaging Het
A2m T C 6: 121,676,890 probably benign Het
Card14 T C 11: 119,324,176 S241P probably damaging Het
Cdh15 G A 8: 122,861,449 probably benign Het
Dnah5 A C 15: 28,448,487 K4232T probably null Het
Eml6 A G 11: 29,831,219 probably benign Het
Frem3 G A 8: 80,615,322 V1415I probably benign Het
Fry T C 5: 150,403,432 probably benign Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Herc1 C T 9: 66,504,840 P4781S probably damaging Het
Iqch G A 9: 63,482,683 S738L probably benign Het
Itih2 T A 2: 10,097,924 T800S probably benign Het
Itpr1 A G 6: 108,410,900 E1533G probably damaging Het
Klrg1 T C 6: 122,279,663 M55V probably benign Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Mkx T A 18: 6,937,192 D284V probably benign Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Otos A C 1: 92,645,351 L14R probably damaging Het
Plch2 C T 4: 154,989,799 V765M probably damaging Het
Ppp4r3b A T 11: 29,173,358 Q18L probably benign Het
Psme4 T A 11: 30,807,687 probably null Het
Pwp1 G A 10: 85,879,309 D220N probably damaging Het
Rel G A 11: 23,757,010 T64I probably damaging Het
Snai2 T A 16: 14,708,247 M254K possibly damaging Het
Sntb2 A G 8: 107,001,577 T386A probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tex22 A G 12: 113,088,523 N67S possibly damaging Het
Trank1 T G 9: 111,347,469 S270A probably benign Het
Ttc30a2 A T 2: 75,976,332 V612D probably benign Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r167 A G 7: 23,505,123 F156S probably benign Het
Vrk2 G A 11: 26,535,522 probably benign Het
Wdfy4 T C 14: 33,140,612 E601G probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp638 A G 6: 83,929,041 N63D probably damaging Het
Other mutations in Esd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Esd APN 14 74736027 missense probably damaging 1.00
IGL00534:Esd APN 14 74738461 missense probably damaging 0.99
IGL00904:Esd APN 14 74749688 makesense probably null
IGL01645:Esd APN 14 74749719 missense probably benign 0.00
IGL03117:Esd APN 14 74741246 missense probably damaging 1.00
R0939:Esd UTSW 14 74736027 missense probably damaging 1.00
R1862:Esd UTSW 14 74742074 missense probably damaging 1.00
R1892:Esd UTSW 14 74749673 missense probably damaging 0.96
R3922:Esd UTSW 14 74743227 missense probably benign 0.00
R4580:Esd UTSW 14 74742077 missense possibly damaging 0.55
R4830:Esd UTSW 14 74741160 missense probably damaging 1.00
R4969:Esd UTSW 14 74744713 missense possibly damaging 0.76
R5211:Esd UTSW 14 74741192 missense probably damaging 1.00
R5335:Esd UTSW 14 74742113 missense probably damaging 0.99
R5810:Esd UTSW 14 74745611 missense probably damaging 1.00
R7024:Esd UTSW 14 74744662 missense probably damaging 1.00
R7759:Esd UTSW 14 74745567 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCACAAGTGGCACGTACCATTCAAG -3'
(R):5'- ACCTGACTGAACCAGCTCTAGGAC -3'

Sequencing Primer
(F):5'- accctgtctcagcctcc -3'
(R):5'- CCAGCTCTAGGACATGAAGGC -3'
Posted On2013-09-30