Mutagenetix > Incidental Mutation

Incidental Mutation 'R0766:Lrrk2'

69518

Institutional Source

Beutler Lab

Gene Symbol

Lrrk2

Ensembl Gene

ENSMUSG00000036273

Gene Name

leucine-rich repeat kinase 2

Synonyms

9330188B09Rik, 4921513O20Rik, LOC381026, cI-46, D630001M17Rik

MMRRC Submission

038946-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.520) question?

Stock #

R0766 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

91673175-91816120 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 91699895 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 286 (N286S)

Ref Sequence

ENSEMBL: ENSMUSP00000052584 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060642]

AlphaFold

Q5S006

Predicted Effect

probably damaging
Transcript: ENSMUST00000060642
AA Change: N286S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000052584
Gene: ENSMUSG00000036273
AA Change: N286S

Domain	Start	End	E-Value	Type
low complexity region	138	156	N/A	INTRINSIC
low complexity region	332	347	N/A	INTRINSIC
ANK	708	737	3.95e1	SMART
ANK	770	800	4.58e2	SMART
low complexity region	890	901	N/A	INTRINSIC
low complexity region	953	966	N/A	INTRINSIC
low complexity region	971	979	N/A	INTRINSIC
LRR	1010	1033	9.96e-1	SMART
LRR	1034	1057	8.01e0	SMART
LRR	1082	1105	2.45e0	SMART
LRR	1128	1151	9.3e-1	SMART
LRR	1195	1219	3.24e0	SMART
LRR	1244	1266	3.87e1	SMART
LRR	1267	1291	4.98e1	SMART
Pfam:Roc	1336	1456	4.9e-32	PFAM
Pfam:Ras	1336	1489	3.3e-17	PFAM
Pfam:COR	1524	1740	4e-28	PFAM
Pfam:Pkinase	1881	2132	4.7e-40	PFAM
Pfam:Pkinase_Tyr	1882	2132	6.8e-39	PFAM
WD40	2231	2276	3.09e-1	SMART
WD40	2401	2438	1.37e2	SMART

Meta Mutation Damage Score

0.2414

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 93.4%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired response to dopamine, amphetamine, and quinpirole. Mice homozygous for one knock-out allele exhibit increased neurite growth. Mice homozygous for different knock-out alleles exhibit alopecia due to excessive grooming or kdiney atrophy. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, knock-out(6) Targeted, other(1)

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921539E11Rik	A	T	4: 103,270,797 (GRCm38)	F44I	probably damaging	Het
A2m	T	C	6: 121,676,890 (GRCm38)		probably benign	Het
Card14	T	C	11: 119,324,176 (GRCm38)	S241P	probably damaging	Het
Cdh15	G	A	8: 122,861,449 (GRCm38)		probably benign	Het
Dnah5	A	C	15: 28,448,487 (GRCm38)	K4232T	probably null	Het
Eml6	A	G	11: 29,831,219 (GRCm38)		probably benign	Het
Esd	T	C	14: 74,742,121 (GRCm38)	S122P	probably damaging	Het
Frem3	G	A	8: 80,615,322 (GRCm38)	V1415I	probably benign	Het
Fry	T	C	5: 150,403,432 (GRCm38)		probably benign	Het
Gp1ba	C	T	11: 70,641,427 (GRCm38)	P673L	probably damaging	Het
Herc1	C	T	9: 66,504,840 (GRCm38)	P4781S	probably damaging	Het
Iqch	G	A	9: 63,482,683 (GRCm38)	S738L	probably benign	Het
Itih2	T	A	2: 10,097,924 (GRCm38)	T800S	probably benign	Het
Itpr1	A	G	6: 108,410,900 (GRCm38)	E1533G	probably damaging	Het
Klrg1	T	C	6: 122,279,663 (GRCm38)	M55V	probably benign	Het
Mkx	T	A	18: 6,937,192 (GRCm38)	D284V	probably benign	Het
Mroh2a	C	T	1: 88,230,680 (GRCm38)	R150*	probably null	Het
Otos	A	C	1: 92,645,351 (GRCm38)	L14R	probably damaging	Het
Plch2	C	T	4: 154,989,799 (GRCm38)	V765M	probably damaging	Het
Ppp4r3b	A	T	11: 29,173,358 (GRCm38)	Q18L	probably benign	Het
Psme4	T	A	11: 30,807,687 (GRCm38)		probably null	Het
Pwp1	G	A	10: 85,879,309 (GRCm38)	D220N	probably damaging	Het
Rel	G	A	11: 23,757,010 (GRCm38)	T64I	probably damaging	Het
Snai2	T	A	16: 14,708,247 (GRCm38)	M254K	possibly damaging	Het
Sntb2	A	G	8: 107,001,577 (GRCm38)	T386A	probably damaging	Het
Tedc2	C	A	17: 24,216,318 (GRCm38)	E366*	probably null	Het
Tedc2	T	A	17: 24,216,317 (GRCm38)	E366V	probably damaging	Het
Tex22	A	G	12: 113,088,523 (GRCm38)	N67S	possibly damaging	Het
Trank1	T	G	9: 111,347,469 (GRCm38)	S270A	probably benign	Het
Ttc30a2	A	T	2: 75,976,332 (GRCm38)	V612D	probably benign	Het
Vcp	T	C	4: 42,988,728 (GRCm38)	T249A	possibly damaging	Het
Vmn1r167	A	G	7: 23,505,123 (GRCm38)	F156S	probably benign	Het
Vrk2	G	A	11: 26,535,522 (GRCm38)		probably benign	Het
Wdfy4	T	C	14: 33,140,612 (GRCm38)	E601G	probably damaging	Het
Zfp407	C	T	18: 84,559,773 (GRCm38)	A1072T	probably benign	Het
Zfp638	A	G	6: 83,929,041 (GRCm38)	N63D	probably damaging	Het

Other mutations in Lrrk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Lrrk2	APN	15	91,747,799 (GRCm38)	missense	possibly damaging	0.90
IGL00542:Lrrk2	APN	15	91,699,943 (GRCm38)	missense	probably benign
IGL00770:Lrrk2	APN	15	91,801,833 (GRCm38)	splice site	probably benign
IGL00774:Lrrk2	APN	15	91,801,833 (GRCm38)	splice site	probably benign
IGL00791:Lrrk2	APN	15	91,779,841 (GRCm38)	missense	probably damaging	1.00
IGL00827:Lrrk2	APN	15	91,755,790 (GRCm38)	missense	probably damaging	1.00
IGL00843:Lrrk2	APN	15	91,757,058 (GRCm38)	missense	possibly damaging	0.58
IGL01109:Lrrk2	APN	15	91,738,832 (GRCm38)	missense	probably damaging	1.00
IGL01293:Lrrk2	APN	15	91,726,137 (GRCm38)	missense	probably benign	0.21
IGL01296:Lrrk2	APN	15	91,683,142 (GRCm38)	missense	probably benign
IGL01301:Lrrk2	APN	15	91,767,339 (GRCm38)	missense	probably damaging	1.00
IGL01360:Lrrk2	APN	15	91,700,569 (GRCm38)	splice site	probably null
IGL01465:Lrrk2	APN	15	91,728,925 (GRCm38)	missense	probably benign	0.21
IGL01529:Lrrk2	APN	15	91,812,313 (GRCm38)	missense	possibly damaging	0.92
IGL01557:Lrrk2	APN	15	91,699,989 (GRCm38)	missense	probably damaging	1.00
IGL01560:Lrrk2	APN	15	91,774,988 (GRCm38)	missense	probably benign	0.33
IGL01991:Lrrk2	APN	15	91,779,946 (GRCm38)	missense	probably damaging	0.99
IGL02003:Lrrk2	APN	15	91,731,491 (GRCm38)	missense	probably damaging	0.99
IGL02325:Lrrk2	APN	15	91,726,308 (GRCm38)	critical splice donor site	probably null
IGL02711:Lrrk2	APN	15	91,685,822 (GRCm38)	missense	possibly damaging	0.71
IGL02869:Lrrk2	APN	15	91,750,277 (GRCm38)	missense	probably damaging	1.00
IGL03104:Lrrk2	APN	15	91,747,755 (GRCm38)	missense	possibly damaging	0.68
IGL03179:Lrrk2	APN	15	91,700,578 (GRCm38)	missense	probably damaging	1.00
IGL03395:Lrrk2	APN	15	91,797,414 (GRCm38)	splice site	probably null
horned	UTSW	15	91,772,858 (GRCm38)	missense	probably damaging	1.00
R1312_Lrrk2_980	UTSW	15	91,699,895 (GRCm38)	missense	probably damaging	1.00
R4710_lrrk2_232	UTSW	15	91,699,927 (GRCm38)	missense	possibly damaging	0.88
R5245_Lrrk2_127	UTSW	15	91,796,089 (GRCm38)	missense	probably damaging	1.00
spree	UTSW	15	91,702,247 (GRCm38)	missense	probably benign	0.00
Spur	UTSW	15	91,774,995 (GRCm38)	nonsense	probably null
3-1:Lrrk2	UTSW	15	91,801,934 (GRCm38)	missense	probably benign	0.01
ANU18:Lrrk2	UTSW	15	91,767,339 (GRCm38)	missense	probably damaging	1.00
H8562:Lrrk2	UTSW	15	91,673,358 (GRCm38)	missense	probably benign
H8786:Lrrk2	UTSW	15	91,673,358 (GRCm38)	missense	probably benign
IGL02835:Lrrk2	UTSW	15	91,814,660 (GRCm38)	critical splice acceptor site	probably null
R0014:Lrrk2	UTSW	15	91,802,045 (GRCm38)	splice site	probably benign
R0014:Lrrk2	UTSW	15	91,802,045 (GRCm38)	splice site	probably benign
R0078:Lrrk2	UTSW	15	91,734,009 (GRCm38)	missense	probably benign	0.01
R0100:Lrrk2	UTSW	15	91,745,796 (GRCm38)	missense	probably damaging	1.00
R0282:Lrrk2	UTSW	15	91,778,414 (GRCm38)	splice site	probably benign
R0448:Lrrk2	UTSW	15	91,709,305 (GRCm38)	missense	probably damaging	0.99
R0449:Lrrk2	UTSW	15	91,750,275 (GRCm38)	missense	probably damaging	1.00
R0610:Lrrk2	UTSW	15	91,815,416 (GRCm38)	missense	probably benign
R0617:Lrrk2	UTSW	15	91,752,278 (GRCm38)	missense	probably benign	0.00
R0632:Lrrk2	UTSW	15	91,796,028 (GRCm38)	missense	probably damaging	0.98
R0639:Lrrk2	UTSW	15	91,772,996 (GRCm38)	missense	probably benign	0.03
R0661:Lrrk2	UTSW	15	91,787,016 (GRCm38)	missense	probably damaging	1.00
R0666:Lrrk2	UTSW	15	91,757,070 (GRCm38)	critical splice donor site	probably null
R0764:Lrrk2	UTSW	15	91,775,046 (GRCm38)	splice site	probably null
R0845:Lrrk2	UTSW	15	91,755,962 (GRCm38)	missense	probably benign	0.22
R0940:Lrrk2	UTSW	15	91,729,081 (GRCm38)	missense	possibly damaging	0.83
R0970:Lrrk2	UTSW	15	91,729,169 (GRCm38)	missense	probably benign	0.22
R1080:Lrrk2	UTSW	15	91,673,689 (GRCm38)	missense	probably benign	0.01
R1114:Lrrk2	UTSW	15	91,700,468 (GRCm38)	nonsense	probably null
R1223:Lrrk2	UTSW	15	91,673,635 (GRCm38)	missense	probably benign	0.00
R1289:Lrrk2	UTSW	15	91,812,360 (GRCm38)	missense	probably benign	0.00
R1296:Lrrk2	UTSW	15	91,728,920 (GRCm38)	missense	probably damaging	1.00
R1312:Lrrk2	UTSW	15	91,699,895 (GRCm38)	missense	probably damaging	1.00
R1637:Lrrk2	UTSW	15	91,734,058 (GRCm38)	missense	probably benign
R1773:Lrrk2	UTSW	15	91,779,981 (GRCm38)	missense	possibly damaging	0.96
R1809:Lrrk2	UTSW	15	91,699,892 (GRCm38)	missense	possibly damaging	0.86
R1839:Lrrk2	UTSW	15	91,683,134 (GRCm38)	missense	probably benign	0.00
R1946:Lrrk2	UTSW	15	91,736,661 (GRCm38)	splice site	probably null
R2160:Lrrk2	UTSW	15	91,796,060 (GRCm38)	missense	probably damaging	1.00
R2232:Lrrk2	UTSW	15	91,764,716 (GRCm38)	missense	probably benign	0.05
R2419:Lrrk2	UTSW	15	91,797,526 (GRCm38)	splice site	probably benign
R2516:Lrrk2	UTSW	15	91,755,927 (GRCm38)	missense	probably benign
R3110:Lrrk2	UTSW	15	91,814,695 (GRCm38)	missense	probably benign	0.02
R3112:Lrrk2	UTSW	15	91,814,695 (GRCm38)	missense	probably benign	0.02
R3801:Lrrk2	UTSW	15	91,737,111 (GRCm38)	missense	probably benign
R3842:Lrrk2	UTSW	15	91,755,916 (GRCm38)	missense	probably benign	0.01
R3903:Lrrk2	UTSW	15	91,747,701 (GRCm38)	missense	probably damaging	1.00
R3903:Lrrk2	UTSW	15	91,747,700 (GRCm38)	missense	probably damaging	1.00
R3930:Lrrk2	UTSW	15	91,767,461 (GRCm38)	critical splice donor site	probably null
R3937:Lrrk2	UTSW	15	91,778,504 (GRCm38)	missense	probably damaging	0.98
R3938:Lrrk2	UTSW	15	91,778,504 (GRCm38)	missense	probably damaging	0.98
R3938:Lrrk2	UTSW	15	91,712,780 (GRCm38)	missense	possibly damaging	0.69
R3982:Lrrk2	UTSW	15	91,709,284 (GRCm38)	missense	probably benign	0.22
R4125:Lrrk2	UTSW	15	91,815,483 (GRCm38)	missense	probably benign	0.01
R4130:Lrrk2	UTSW	15	91,755,794 (GRCm38)	missense	probably benign	0.19
R4296:Lrrk2	UTSW	15	91,699,895 (GRCm38)	missense	probably damaging	1.00
R4465:Lrrk2	UTSW	15	91,747,820 (GRCm38)	missense	probably damaging	0.96
R4478:Lrrk2	UTSW	15	91,723,188 (GRCm38)	missense	probably damaging	1.00
R4517:Lrrk2	UTSW	15	91,705,120 (GRCm38)	missense	probably benign
R4539:Lrrk2	UTSW	15	91,729,142 (GRCm38)	missense	possibly damaging	0.86
R4654:Lrrk2	UTSW	15	91,765,681 (GRCm38)	missense	probably damaging	0.96
R4710:Lrrk2	UTSW	15	91,699,927 (GRCm38)	missense	possibly damaging	0.88
R4722:Lrrk2	UTSW	15	91,688,901 (GRCm38)	missense	probably damaging	1.00
R4723:Lrrk2	UTSW	15	91,764,759 (GRCm38)	missense	probably damaging	1.00
R4732:Lrrk2	UTSW	15	91,765,747 (GRCm38)	missense	probably damaging	1.00
R4732:Lrrk2	UTSW	15	91,688,849 (GRCm38)	missense	probably damaging	1.00
R4733:Lrrk2	UTSW	15	91,765,747 (GRCm38)	missense	probably damaging	1.00
R4733:Lrrk2	UTSW	15	91,688,849 (GRCm38)	missense	probably damaging	1.00
R4787:Lrrk2	UTSW	15	91,712,828 (GRCm38)	missense	probably benign
R4945:Lrrk2	UTSW	15	91,804,920 (GRCm38)	missense	probably benign	0.02
R4948:Lrrk2	UTSW	15	91,803,389 (GRCm38)	missense	probably benign	0.20
R5000:Lrrk2	UTSW	15	91,749,878 (GRCm38)	missense	probably damaging	1.00
R5031:Lrrk2	UTSW	15	91,700,619 (GRCm38)	missense	possibly damaging	0.50
R5067:Lrrk2	UTSW	15	91,765,790 (GRCm38)	missense	probably benign	0.01
R5245:Lrrk2	UTSW	15	91,796,089 (GRCm38)	missense	probably damaging	1.00
R5341:Lrrk2	UTSW	15	91,772,858 (GRCm38)	missense	probably damaging	1.00
R5460:Lrrk2	UTSW	15	91,814,644 (GRCm38)	splice site	probably null
R5551:Lrrk2	UTSW	15	91,812,350 (GRCm38)	missense	probably benign
R5574:Lrrk2	UTSW	15	91,787,016 (GRCm38)	missense	probably damaging	1.00
R5577:Lrrk2	UTSW	15	91,765,745 (GRCm38)	missense	probably damaging	1.00
R5685:Lrrk2	UTSW	15	91,803,301 (GRCm38)	nonsense	probably null
R5712:Lrrk2	UTSW	15	91,702,222 (GRCm38)	nonsense	probably null
R5728:Lrrk2	UTSW	15	91,774,974 (GRCm38)	missense	probably benign	0.36
R5782:Lrrk2	UTSW	15	91,702,183 (GRCm38)	missense	probably damaging	1.00
R5788:Lrrk2	UTSW	15	91,764,648 (GRCm38)	missense	possibly damaging	0.55
R5821:Lrrk2	UTSW	15	91,709,390 (GRCm38)	critical splice donor site	probably null
R5852:Lrrk2	UTSW	15	91,755,949 (GRCm38)	missense	probably damaging	1.00
R5934:Lrrk2	UTSW	15	91,734,046 (GRCm38)	missense	probably benign	0.00
R5935:Lrrk2	UTSW	15	91,745,831 (GRCm38)	missense	probably benign	0.14
R5979:Lrrk2	UTSW	15	91,772,945 (GRCm38)	missense	possibly damaging	0.47
R6101:Lrrk2	UTSW	15	91,723,135 (GRCm38)	missense	probably benign	0.10
R6114:Lrrk2	UTSW	15	91,747,826 (GRCm38)	missense	probably benign	0.33
R6259:Lrrk2	UTSW	15	91,702,247 (GRCm38)	missense	probably benign	0.00
R6376:Lrrk2	UTSW	15	91,742,266 (GRCm38)	missense	possibly damaging	0.89
R6417:Lrrk2	UTSW	15	91,812,346 (GRCm38)	missense	probably benign	0.03
R6420:Lrrk2	UTSW	15	91,812,346 (GRCm38)	missense	probably benign	0.03
R6737:Lrrk2	UTSW	15	91,723,218 (GRCm38)	missense	possibly damaging	0.50
R7056:Lrrk2	UTSW	15	91,774,995 (GRCm38)	nonsense	probably null
R7072:Lrrk2	UTSW	15	91,801,920 (GRCm38)	missense	probably benign	0.03
R7109:Lrrk2	UTSW	15	91,764,782 (GRCm38)	missense	probably damaging	1.00
R7128:Lrrk2	UTSW	15	91,801,885 (GRCm38)	missense	probably benign
R7144:Lrrk2	UTSW	15	91,734,055 (GRCm38)	missense	possibly damaging	0.54
R7187:Lrrk2	UTSW	15	91,757,001 (GRCm38)	missense	possibly damaging	0.92
R7270:Lrrk2	UTSW	15	91,700,441 (GRCm38)	missense	probably benign	0.01
R7356:Lrrk2	UTSW	15	91,738,744 (GRCm38)	missense	probably benign	0.07
R7360:Lrrk2	UTSW	15	91,731,655 (GRCm38)	critical splice donor site	probably null
R7373:Lrrk2	UTSW	15	91,700,004 (GRCm38)	critical splice donor site	probably null
R7465:Lrrk2	UTSW	15	91,767,340 (GRCm38)	missense	probably damaging	1.00
R7477:Lrrk2	UTSW	15	91,812,325 (GRCm38)	missense	probably damaging	0.98
R7614:Lrrk2	UTSW	15	91,772,858 (GRCm38)	missense	probably damaging	1.00
R7622:Lrrk2	UTSW	15	91,812,323 (GRCm38)	missense	probably damaging	1.00
R7658:Lrrk2	UTSW	15	91,700,358 (GRCm38)	missense	possibly damaging	0.91
R7679:Lrrk2	UTSW	15	91,726,186 (GRCm38)	missense	possibly damaging	0.58
R7737:Lrrk2	UTSW	15	91,815,446 (GRCm38)	missense	probably damaging	0.98
R7739:Lrrk2	UTSW	15	91,700,613 (GRCm38)	missense	probably damaging	1.00
R7740:Lrrk2	UTSW	15	91,767,324 (GRCm38)	missense	probably damaging	1.00
R7908:Lrrk2	UTSW	15	91,726,152 (GRCm38)	missense	probably damaging	1.00
R8299:Lrrk2	UTSW	15	91,673,240 (GRCm38)	start gained	probably benign
R8389:Lrrk2	UTSW	15	91,699,991 (GRCm38)	missense	probably damaging	1.00
R8462:Lrrk2	UTSW	15	91,731,477 (GRCm38)	missense	probably benign
R8698:Lrrk2	UTSW	15	91,752,197 (GRCm38)	missense	probably benign	0.38
R8947:Lrrk2	UTSW	15	91,702,270 (GRCm38)	nonsense	probably null
R9084:Lrrk2	UTSW	15	91,750,266 (GRCm38)	missense
R9086:Lrrk2	UTSW	15	91,755,848 (GRCm38)	missense	probably benign	0.01
R9096:Lrrk2	UTSW	15	91,673,256 (GRCm38)	start gained	probably benign
R9097:Lrrk2	UTSW	15	91,673,256 (GRCm38)	start gained	probably benign
R9267:Lrrk2	UTSW	15	91,700,426 (GRCm38)	missense	probably damaging	0.99
R9285:Lrrk2	UTSW	15	91,778,483 (GRCm38)	missense	probably damaging	1.00
R9341:Lrrk2	UTSW	15	91,700,415 (GRCm38)	missense	probably benign	0.18
R9343:Lrrk2	UTSW	15	91,700,415 (GRCm38)	missense	probably benign	0.18
R9371:Lrrk2	UTSW	15	91,723,204 (GRCm38)	missense	probably damaging	1.00
R9424:Lrrk2	UTSW	15	91,752,185 (GRCm38)	nonsense	probably null
R9489:Lrrk2	UTSW	15	91,737,217 (GRCm38)	missense	probably benign	0.37
R9502:Lrrk2	UTSW	15	91,723,162 (GRCm38)	missense	probably damaging	0.98
R9563:Lrrk2	UTSW	15	91,749,840 (GRCm38)	missense	possibly damaging	0.90
R9576:Lrrk2	UTSW	15	91,752,185 (GRCm38)	nonsense	probably null
R9605:Lrrk2	UTSW	15	91,737,217 (GRCm38)	missense	probably benign	0.37
R9635:Lrrk2	UTSW	15	91,812,324 (GRCm38)	missense	probably benign	0.21
R9641:Lrrk2	UTSW	15	91,787,048 (GRCm38)	missense	possibly damaging	0.94
R9660:Lrrk2	UTSW	15	91,734,025 (GRCm38)	missense	probably benign	0.00
R9673:Lrrk2	UTSW	15	91,765,681 (GRCm38)	missense	probably damaging	1.00
R9708:Lrrk2	UTSW	15	91,750,279 (GRCm38)	nonsense	probably null
R9728:Lrrk2	UTSW	15	91,734,025 (GRCm38)	missense	probably benign	0.00
R9757:Lrrk2	UTSW	15	91,811,026 (GRCm38)	missense	probably benign	0.03
RF001:Lrrk2	UTSW	15	91,736,633 (GRCm38)	missense	probably benign	0.11
X0028:Lrrk2	UTSW	15	91,738,851 (GRCm38)	missense	probably benign	0.00
Z1088:Lrrk2	UTSW	15	91,726,240 (GRCm38)	missense	probably benign	0.12

Predicted Primers

PCR Primer
(F):5'- CTGGTCTTACTCAGCCAGCAAAGTC -3'
(R):5'- TGCTCCAAGAGCATCTTTCCGAC -3'

Sequencing Primer
(F):5'- CCAGAGTTTCAAAAAGTCTCTTGC -3'
(R):5'- TTTCCGACTGGAAGAAGGTCC -3'

Posted On

2013-09-30