Incidental Mutation 'R0766:Snai2'
List [record 1 of 37] next >> last >|
Institutional Source Beutler Lab
Gene Symbol Snai2
Ensembl Gene ENSMUSG00000022676
Gene Namesnail family zinc finger 2
SynonymsSnail2, Slug, Slugh
MMRRC Submission 038946-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.861) question?
Stock #R0766 (G1)
Quality Score225
Status Validated
Chromosomal Location14705852-14709385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14708247 bp
Amino Acid Change Methionine to Lysine at position 254 (M254K)
Ref Sequence ENSEMBL: ENSMUSP00000023356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023356]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023356
AA Change: M254K

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023356
Gene: ENSMUSG00000022676
AA Change: M254K

PDB:3W5K|B 1 59 4e-6 PDB
low complexity region 60 84 N/A INTRINSIC
low complexity region 88 105 N/A INTRINSIC
ZnF_C2H2 129 151 4.17e-3 SMART
ZnF_C2H2 160 182 6.88e-4 SMART
ZnF_C2H2 186 208 7.26e-3 SMART
ZnF_C2H2 214 236 9.88e-5 SMART
ZnF_C2H2 242 269 6.15e1 SMART
Meta Mutation Damage Score 0.4415 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.4%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Snail family of C2H2-type zinc finger transcription factors. The encoded protein acts as a transcriptional repressor that binds to E-box motifs and is also likely to repress E-cadherin transcription in breast carcinoma. This protein is involved in epithelial-mesenchymal transitions and has antiapoptotic activity. Mutations in this gene may be associated with sporatic cases of neural tube defects. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in growth retardation and eyelid deformities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A T 4: 103,270,797 F44I probably damaging Het
A2m T C 6: 121,676,890 probably benign Het
Card14 T C 11: 119,324,176 S241P probably damaging Het
Cdh15 G A 8: 122,861,449 probably benign Het
Dnah5 A C 15: 28,448,487 K4232T probably null Het
Eml6 A G 11: 29,831,219 probably benign Het
Esd T C 14: 74,742,121 S122P probably damaging Het
Frem3 G A 8: 80,615,322 V1415I probably benign Het
Fry T C 5: 150,403,432 probably benign Het
Gp1ba C T 11: 70,641,427 P673L probably damaging Het
Herc1 C T 9: 66,504,840 P4781S probably damaging Het
Iqch G A 9: 63,482,683 S738L probably benign Het
Itih2 T A 2: 10,097,924 T800S probably benign Het
Itpr1 A G 6: 108,410,900 E1533G probably damaging Het
Klrg1 T C 6: 122,279,663 M55V probably benign Het
Lrrk2 A G 15: 91,699,895 N286S probably damaging Het
Mkx T A 18: 6,937,192 D284V probably benign Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Otos A C 1: 92,645,351 L14R probably damaging Het
Plch2 C T 4: 154,989,799 V765M probably damaging Het
Ppp4r3b A T 11: 29,173,358 Q18L probably benign Het
Psme4 T A 11: 30,807,687 probably null Het
Pwp1 G A 10: 85,879,309 D220N probably damaging Het
Rel G A 11: 23,757,010 T64I probably damaging Het
Sntb2 A G 8: 107,001,577 T386A probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tex22 A G 12: 113,088,523 N67S possibly damaging Het
Trank1 T G 9: 111,347,469 S270A probably benign Het
Ttc30a2 A T 2: 75,976,332 V612D probably benign Het
Vcp T C 4: 42,988,728 T249A possibly damaging Het
Vmn1r167 A G 7: 23,505,123 F156S probably benign Het
Vrk2 G A 11: 26,535,522 probably benign Het
Wdfy4 T C 14: 33,140,612 E601G probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp638 A G 6: 83,929,041 N63D probably damaging Het
Other mutations in Snai2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Snai2 APN 16 14706771 missense probably benign 0.02
IGL03295:Snai2 APN 16 14706774 missense possibly damaging 0.64
IGL03412:Snai2 APN 16 14707256 missense possibly damaging 0.91
R0765:Snai2 UTSW 16 14706804 missense possibly damaging 0.85
R1419:Snai2 UTSW 16 14708180 missense possibly damaging 0.85
R1669:Snai2 UTSW 16 14707044 missense possibly damaging 0.95
R2096:Snai2 UTSW 16 14706997 missense possibly damaging 0.86
R2496:Snai2 UTSW 16 14706002 missense possibly damaging 0.86
R2901:Snai2 UTSW 16 14705983 missense possibly damaging 0.93
R4682:Snai2 UTSW 16 14708286 missense probably benign
R4832:Snai2 UTSW 16 14707017 missense probably damaging 0.97
R4879:Snai2 UTSW 16 14706741 missense probably benign
R5025:Snai2 UTSW 16 14708189 missense possibly damaging 0.95
R5794:Snai2 UTSW 16 14706726 missense probably benign
R6143:Snai2 UTSW 16 14708243 nonsense probably null
R6980:Snai2 UTSW 16 14708249 missense possibly damaging 0.92
R7096:Snai2 UTSW 16 14707164 missense possibly damaging 0.93
R7121:Snai2 UTSW 16 14707106 missense probably benign 0.00
R7501:Snai2 UTSW 16 14706890 missense possibly damaging 0.70
R8160:Snai2 UTSW 16 14706804 missense possibly damaging 0.85
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ttgtgtcctataaaaagctgactg -3'
(R):5'- ctctctctctctctctctctctc -3'
Posted On2013-09-30