Incidental Mutation 'R9154:Speer4f2'
ID 695216
Institutional Source Beutler Lab
Gene Symbol Speer4f2
Ensembl Gene ENSMUSG00000091827
Gene Name spermatogenesis associated glutamate (E)-rich protein 4f2
Synonyms Gm3535, Gm3495
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock # R9154 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 17373180-17378028 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 17376612 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 184 (L184Q)
Ref Sequence ENSEMBL: ENSMUSP00000129818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166086]
AlphaFold E9Q366
Predicted Effect
SMART Domains Protein: ENSMUSP00000129818
Gene: ENSMUSG00000091827
AA Change: L184Q

DomainStartEndE-ValueType
Pfam:Takusan 34 112 9.6e-20 PFAM
low complexity region 208 253 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik A T 14: 49,235,910 H129Q probably benign Het
4930590J08Rik T C 6: 91,949,945 V862A probably benign Het
A2m A T 6: 121,668,553 K1019M probably damaging Het
Acot6 G T 12: 84,101,015 W15L possibly damaging Het
Adam32 CCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAG 8: 24,948,753 probably benign Het
Adnp C A 2: 168,184,660 Q238H possibly damaging Het
Akap7 T C 10: 25,171,155 Y281C probably damaging Het
Ank1 A G 8: 23,115,371 E1085G probably damaging Het
Arhgef38 A T 3: 133,132,163 S669T unknown Het
Atp8b2 A T 3: 89,958,620 S50R possibly damaging Het
Atp8b5 T C 4: 43,372,630 I1090T probably benign Het
Chrna4 G A 2: 181,028,809 R385C probably damaging Het
Col4a1 T A 8: 11,217,446 I1105F probably damaging Het
Crybg2 G A 4: 134,065,309 R85Q probably benign Het
Cspg4 T A 9: 56,891,003 L1434Q Het
Cyp3a13 T C 5: 137,921,496 N6S probably benign Het
Dnase2b A T 3: 146,593,571 Y42* probably null Het
F11r A G 1: 171,461,808 E233G probably damaging Het
Fip1l1 T C 5: 74,587,042 I390T possibly damaging Het
Fiz1 G A 7: 5,008,281 R413C probably damaging Het
Fus G A 7: 127,981,268 G450E unknown Het
Gm11569 C A 11: 99,798,441 C144F unknown Het
Gm7298 A T 6: 121,779,477 Y1027F probably damaging Het
Grik5 C A 7: 25,058,978 W340L probably damaging Het
Hectd4 G A 5: 121,253,904 R77H Het
Hist1h1c A G 13: 23,739,390 K181R unknown Het
Ift81 C A 5: 122,551,059 V665L probably benign Het
Ints2 A G 11: 86,234,698 F559L probably damaging Het
Kdm8 G A 7: 125,455,124 V176I probably benign Het
Keap1 A T 9: 21,230,825 Y584* probably null Het
Klra1 T C 6: 130,380,644 T7A Het
Lmo7 T A 14: 101,885,307 W311R probably damaging Het
Lrp6 A G 6: 134,541,892 V70A probably damaging Het
Luc7l3 A T 11: 94,299,967 S174T unknown Het
Madd T C 2: 91,167,817 T653A probably damaging Het
Mlph G T 1: 90,927,994 G41V probably damaging Het
Mov10l1 A G 15: 89,011,915 E654G possibly damaging Het
Mpp3 T C 11: 102,020,502 I165V Het
Mrgpra2a T G 7: 47,426,646 Y288S probably damaging Het
Mroh9 T A 1: 163,062,461 M236L Het
Muc5b A C 7: 141,864,237 K3640T probably damaging Het
Myh13 A G 11: 67,362,492 I1485V probably benign Het
Nf2 A T 11: 4,794,873 F285L probably damaging Het
Nfx1 T A 4: 40,990,845 C471S probably damaging Het
Nsd1 C T 13: 55,213,440 R74W probably damaging Het
Nudt16l1 A T 16: 4,940,417 *212C probably null Het
Oaf T C 9: 43,222,695 Y243C probably damaging Het
Olfr558 T C 7: 102,709,334 V25A probably benign Het
Olfr788 T C 10: 129,472,821 I43T probably benign Het
Olfr849 T A 9: 19,441,235 F107L probably benign Het
Olfr871 A G 9: 20,212,877 H176R possibly damaging Het
Olfr883 T A 9: 38,026,394 L196* probably null Het
Parp9 T C 16: 35,948,173 I241T probably damaging Het
Phlpp2 G T 8: 109,939,958 A1040S possibly damaging Het
Pon2 A T 6: 5,265,391 V332E possibly damaging Het
Ptprc A G 1: 138,088,564 V544A probably damaging Het
Rfx6 A G 10: 51,721,504 S446G probably benign Het
Rnf103 T A 6: 71,510,115 C577S probably benign Het
Ros1 T G 10: 52,046,205 E2278D possibly damaging Het
Rpl37 A G 15: 5,117,627 S50G probably benign Het
Rrad C T 8: 104,628,711 V222M possibly damaging Het
Ryr1 T C 7: 29,069,858 T2770A probably benign Het
Secisbp2l G A 2: 125,775,703 P18L probably damaging Het
Sept2 T A 1: 93,501,588 W260R probably damaging Het
Slc35c2 A G 2: 165,280,877 M117T probably benign Het
Slc44a5 A G 3: 154,247,736 T252A probably benign Het
Sphkap C G 1: 83,257,261 V1615L probably damaging Het
Sult2a3 C T 7: 14,073,056 V234I probably benign Het
Tanc1 T C 2: 59,799,788 L704P probably damaging Het
Tas2r126 T C 6: 42,435,240 S236P probably benign Het
Tnik A G 3: 28,650,086 I1020V probably damaging Het
Tomm5 T C 4: 45,106,724 Q64R unknown Het
Ttll13 A G 7: 80,247,434 E16G probably benign Het
Vmn1r21 C A 6: 57,844,363 C32F probably benign Het
Vmn2r51 T A 7: 10,105,553 D36V probably damaging Het
Vmn2r63 C T 7: 42,926,989 D467N probably damaging Het
Vwce A G 19: 10,648,486 N454S possibly damaging Het
Wfdc1 A C 8: 119,679,377 D77A Het
Yme1l1 T A 2: 23,187,803 I419N probably damaging Het
Zfp106 G A 2: 120,534,331 Q555* probably null Het
Zfp773 A C 7: 7,135,303 M111R probably damaging Het
Zmat3 G A 3: 32,343,618 A165V possibly damaging Het
Other mutations in Speer4f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Speer4f2 APN 5 17376567 missense possibly damaging 0.94
IGL02092:Speer4f2 APN 5 17376629 nonsense probably null
IGL03100:Speer4f2 APN 5 17376530 missense probably damaging 0.99
R0939:Speer4f2 UTSW 5 17374404 missense probably damaging 0.99
R1384:Speer4f2 UTSW 5 17374449 missense probably damaging 1.00
R1528:Speer4f2 UTSW 5 17376542 missense
R1873:Speer4f2 UTSW 5 17374449 missense probably damaging 1.00
R3608:Speer4f2 UTSW 5 17374494 missense probably benign 0.03
R4972:Speer4f2 UTSW 5 17374425 missense probably benign 0.27
R5421:Speer4f2 UTSW 5 17374358 missense possibly damaging 0.88
R5450:Speer4f2 UTSW 5 17373219 missense possibly damaging 0.85
R5452:Speer4f2 UTSW 5 17376500 missense possibly damaging 0.93
R5531:Speer4f2 UTSW 5 17376528 missense possibly damaging 0.57
R5924:Speer4f2 UTSW 5 17376624 missense probably damaging 1.00
R6454:Speer4f2 UTSW 5 17374433 missense probably damaging 0.99
R6553:Speer4f2 UTSW 5 17374422 missense probably damaging 1.00
R6585:Speer4f2 UTSW 5 17374422 missense probably damaging 1.00
R6649:Speer4f2 UTSW 5 17375769 missense probably benign 0.05
R6878:Speer4f2 UTSW 5 17375767 missense probably damaging 0.99
R7089:Speer4f2 UTSW 5 17376663 missense
R7129:Speer4f2 UTSW 5 17377448 missense
R7448:Speer4f2 UTSW 5 17376542 missense
R7654:Speer4f2 UTSW 5 17374415 missense
R7942:Speer4f2 UTSW 5 17377632 missense unknown
R8170:Speer4f2 UTSW 5 17374461 missense
R8409:Speer4f2 UTSW 5 17377421 missense
Predicted Primers PCR Primer
(F):5'- CCAGGGTACAGGTCAGGTTAATG -3'
(R):5'- GGCTTGTGTGAAGACAGAGC -3'

Sequencing Primer
(F):5'- AGGTTAATGGGACCTGTAAGTAG -3'
(R):5'- TGAACAGCTACATTCCATGAGG -3'
Posted On 2022-01-20