Incidental Mutation 'R0766:Zfp407'
ID 69523
Institutional Source Beutler Lab
Gene Symbol Zfp407
Ensembl Gene ENSMUSG00000048410
Gene Name zinc finger protein 407
Synonyms LOC381139, 6430585N13Rik, LOC240469
MMRRC Submission 038946-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0766 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 84225826-84612815 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 84577898 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 1072 (A1072T)
Ref Sequence ENSEMBL: ENSMUSP00000118361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000125763]
AlphaFold G3UVV3
Predicted Effect probably benign
Transcript: ENSMUST00000125450
Predicted Effect probably benign
Transcript: ENSMUST00000125763
AA Change: A1072T

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118361
Gene: ENSMUSG00000048410
AA Change: A1072T

DomainStartEndE-ValueType
low complexity region 20 37 N/A INTRINSIC
ZnF_C2H2 178 200 8.67e-1 SMART
ZnF_U1 233 267 6.79e-1 SMART
ZnF_C2H2 236 260 4.65e-1 SMART
ZnF_C2H2 522 545 7.05e-1 SMART
ZnF_U1 548 582 1.54e1 SMART
ZnF_C2H2 551 575 1.01e-1 SMART
ZnF_C2H2 582 605 1.41e0 SMART
ZnF_U1 606 639 2.22e0 SMART
ZnF_C2H2 609 632 1.01e2 SMART
ZnF_C2H2 695 718 6.23e-2 SMART
ZnF_U1 721 755 2.96e0 SMART
ZnF_C2H2 724 748 7.11e0 SMART
ZnF_C2H2 840 863 7.55e-1 SMART
ZnF_U1 866 900 3.81e-1 SMART
ZnF_C2H2 869 893 1.07e0 SMART
ZnF_C2H2 1009 1032 6.13e-1 SMART
ZnF_U1 1035 1069 2.22e0 SMART
ZnF_C2H2 1038 1062 5.62e0 SMART
low complexity region 1223 1234 N/A INTRINSIC
ZnF_C2H2 1405 1428 5.92e0 SMART
ZnF_U1 1432 1466 2.35e0 SMART
ZnF_C2H2 1435 1459 1.76e-1 SMART
ZnF_C2H2 1477 1500 5.42e-2 SMART
ZnF_C2H2 1528 1552 1.68e1 SMART
ZnF_C2H2 1558 1580 1.43e-1 SMART
ZnF_C2H2 1586 1609 9.58e-3 SMART
ZnF_C2H2 1619 1641 2.61e-4 SMART
ZnF_C2H2 1647 1671 1.04e-3 SMART
ZnF_C2H2 1677 1699 9.44e-2 SMART
ZnF_C2H2 1705 1727 1.82e-3 SMART
ZnF_C2H2 1733 1758 4.65e-1 SMART
ZnF_C2H2 1764 1787 1.26e-2 SMART
low complexity region 1876 1887 N/A INTRINSIC
low complexity region 2017 2032 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156181
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182297
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.4%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein whose exact function is not known. It may be involved in transcriptional regulation. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik A T 4: 103,127,994 (GRCm39) F44I probably damaging Het
A2m T C 6: 121,653,849 (GRCm39) probably benign Het
Card14 T C 11: 119,215,002 (GRCm39) S241P probably damaging Het
Cdh15 G A 8: 123,588,188 (GRCm39) probably benign Het
Dnah5 A C 15: 28,448,633 (GRCm39) K4232T probably null Het
Eml6 A G 11: 29,781,219 (GRCm39) probably benign Het
Esd T C 14: 74,979,561 (GRCm39) S122P probably damaging Het
Frem3 G A 8: 81,341,951 (GRCm39) V1415I probably benign Het
Fry T C 5: 150,326,897 (GRCm39) probably benign Het
Gp1ba C T 11: 70,532,253 (GRCm39) P673L probably damaging Het
Herc1 C T 9: 66,412,122 (GRCm39) P4781S probably damaging Het
Ift70a2 A T 2: 75,806,676 (GRCm39) V612D probably benign Het
Iqch G A 9: 63,389,965 (GRCm39) S738L probably benign Het
Itih2 T A 2: 10,102,735 (GRCm39) T800S probably benign Het
Itpr1 A G 6: 108,387,861 (GRCm39) E1533G probably damaging Het
Klrg1 T C 6: 122,256,622 (GRCm39) M55V probably benign Het
Lrrk2 A G 15: 91,584,098 (GRCm39) N286S probably damaging Het
Mkx T A 18: 6,937,192 (GRCm39) D284V probably benign Het
Mroh2a C T 1: 88,158,402 (GRCm39) R150* probably null Het
Otos A C 1: 92,573,073 (GRCm39) L14R probably damaging Het
Plch2 C T 4: 155,074,256 (GRCm39) V765M probably damaging Het
Ppp4r3b A T 11: 29,123,358 (GRCm39) Q18L probably benign Het
Psme4 T A 11: 30,757,687 (GRCm39) probably null Het
Pwp1 G A 10: 85,715,173 (GRCm39) D220N probably damaging Het
Rel G A 11: 23,707,010 (GRCm39) T64I probably damaging Het
Snai2 T A 16: 14,526,111 (GRCm39) M254K possibly damaging Het
Sntb2 A G 8: 107,728,209 (GRCm39) T386A probably damaging Het
Tedc2 T A 17: 24,435,291 (GRCm39) E366V probably damaging Het
Tedc2 C A 17: 24,435,292 (GRCm39) E366* probably null Het
Tex22 A G 12: 113,052,143 (GRCm39) N67S possibly damaging Het
Trank1 T G 9: 111,176,537 (GRCm39) S270A probably benign Het
Vcp T C 4: 42,988,728 (GRCm39) T249A possibly damaging Het
Vmn1r167 A G 7: 23,204,548 (GRCm39) F156S probably benign Het
Vrk2 G A 11: 26,485,522 (GRCm39) probably benign Het
Wdfy4 T C 14: 32,862,569 (GRCm39) E601G probably damaging Het
Zfp638 A G 6: 83,906,023 (GRCm39) N63D probably damaging Het
Other mutations in Zfp407
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Zfp407 APN 18 84,579,877 (GRCm39) missense probably damaging 0.99
IGL02105:Zfp407 APN 18 84,580,845 (GRCm39) nonsense probably null
IGL02110:Zfp407 APN 18 84,577,165 (GRCm39) missense probably benign 0.00
IGL02343:Zfp407 APN 18 84,227,849 (GRCm39) missense possibly damaging 0.71
IGL02456:Zfp407 APN 18 84,576,766 (GRCm39) missense probably damaging 1.00
IGL02705:Zfp407 APN 18 84,577,156 (GRCm39) nonsense probably null
IGL02946:Zfp407 APN 18 84,578,834 (GRCm39) missense probably damaging 1.00
IGL03069:Zfp407 APN 18 84,369,100 (GRCm39) missense probably damaging 1.00
IGL03145:Zfp407 APN 18 84,227,846 (GRCm39) missense probably damaging 0.99
IGL03403:Zfp407 APN 18 84,578,922 (GRCm39) missense probably damaging 1.00
IGL03134:Zfp407 UTSW 18 84,228,080 (GRCm39) missense probably damaging 0.99
PIT4362001:Zfp407 UTSW 18 84,579,393 (GRCm39) missense possibly damaging 0.87
PIT4520001:Zfp407 UTSW 18 84,450,545 (GRCm39) missense probably damaging 0.99
R0087:Zfp407 UTSW 18 84,578,536 (GRCm39) missense probably damaging 1.00
R0243:Zfp407 UTSW 18 84,576,836 (GRCm39) missense probably damaging 1.00
R0594:Zfp407 UTSW 18 84,580,692 (GRCm39) missense possibly damaging 0.87
R0787:Zfp407 UTSW 18 84,227,471 (GRCm39) missense probably benign 0.00
R0787:Zfp407 UTSW 18 84,227,147 (GRCm39) missense probably damaging 1.00
R1065:Zfp407 UTSW 18 84,577,898 (GRCm39) missense probably benign 0.14
R1086:Zfp407 UTSW 18 84,577,898 (GRCm39) missense probably benign 0.14
R1165:Zfp407 UTSW 18 84,577,898 (GRCm39) missense probably benign 0.14
R1186:Zfp407 UTSW 18 84,227,573 (GRCm39) missense probably benign 0.39
R1203:Zfp407 UTSW 18 84,577,898 (GRCm39) missense probably benign 0.14
R1312:Zfp407 UTSW 18 84,577,898 (GRCm39) missense probably benign 0.14
R1345:Zfp407 UTSW 18 84,577,898 (GRCm39) missense probably benign 0.14
R1385:Zfp407 UTSW 18 84,577,898 (GRCm39) missense probably benign 0.14
R1421:Zfp407 UTSW 18 84,577,898 (GRCm39) missense probably benign 0.14
R1430:Zfp407 UTSW 18 84,227,580 (GRCm39) missense probably benign 0.18
R1436:Zfp407 UTSW 18 84,361,196 (GRCm39) splice site probably benign
R1498:Zfp407 UTSW 18 84,577,898 (GRCm39) missense probably benign 0.14
R1526:Zfp407 UTSW 18 84,579,158 (GRCm39) missense possibly damaging 0.61
R1579:Zfp407 UTSW 18 84,227,763 (GRCm39) missense probably benign 0.00
R1594:Zfp407 UTSW 18 84,227,456 (GRCm39) missense probably benign 0.01
R1628:Zfp407 UTSW 18 84,372,658 (GRCm39) missense probably damaging 1.00
R1698:Zfp407 UTSW 18 84,580,282 (GRCm39) missense probably damaging 1.00
R1962:Zfp407 UTSW 18 84,577,461 (GRCm39) missense probably benign 0.01
R1984:Zfp407 UTSW 18 84,577,898 (GRCm39) missense probably benign 0.14
R1985:Zfp407 UTSW 18 84,577,898 (GRCm39) missense probably benign 0.14
R1986:Zfp407 UTSW 18 84,577,898 (GRCm39) missense probably benign 0.14
R2151:Zfp407 UTSW 18 84,227,774 (GRCm39) missense possibly damaging 0.55
R2152:Zfp407 UTSW 18 84,227,774 (GRCm39) missense possibly damaging 0.55
R2154:Zfp407 UTSW 18 84,227,774 (GRCm39) missense possibly damaging 0.55
R2259:Zfp407 UTSW 18 84,227,918 (GRCm39) missense probably damaging 1.00
R2353:Zfp407 UTSW 18 84,578,005 (GRCm39) missense probably damaging 1.00
R2845:Zfp407 UTSW 18 84,576,522 (GRCm39) nonsense probably null
R3407:Zfp407 UTSW 18 84,576,997 (GRCm39) missense probably benign 0.08
R3432:Zfp407 UTSW 18 84,226,871 (GRCm39) missense probably damaging 1.00
R3892:Zfp407 UTSW 18 84,578,477 (GRCm39) missense probably damaging 1.00
R4026:Zfp407 UTSW 18 84,577,721 (GRCm39) missense possibly damaging 0.82
R4107:Zfp407 UTSW 18 84,361,132 (GRCm39) missense possibly damaging 0.82
R4398:Zfp407 UTSW 18 84,580,856 (GRCm39) nonsense probably null
R4447:Zfp407 UTSW 18 84,580,819 (GRCm39) missense possibly damaging 0.95
R4752:Zfp407 UTSW 18 84,581,039 (GRCm39) missense probably benign 0.01
R4881:Zfp407 UTSW 18 84,577,828 (GRCm39) missense probably benign 0.27
R4936:Zfp407 UTSW 18 84,577,589 (GRCm39) missense probably benign 0.00
R5194:Zfp407 UTSW 18 84,579,434 (GRCm39) missense probably benign 0.05
R5243:Zfp407 UTSW 18 84,579,216 (GRCm39) missense probably damaging 1.00
R5258:Zfp407 UTSW 18 84,334,051 (GRCm39) missense probably damaging 1.00
R5591:Zfp407 UTSW 18 84,579,262 (GRCm39) missense probably damaging 1.00
R5633:Zfp407 UTSW 18 84,579,169 (GRCm39) missense probably benign 0.35
R5739:Zfp407 UTSW 18 84,226,867 (GRCm39) makesense probably null
R5806:Zfp407 UTSW 18 84,576,739 (GRCm39) missense probably damaging 1.00
R5820:Zfp407 UTSW 18 84,578,649 (GRCm39) missense probably benign 0.01
R6187:Zfp407 UTSW 18 84,577,134 (GRCm39) missense possibly damaging 0.87
R6512:Zfp407 UTSW 18 84,578,474 (GRCm39) missense probably damaging 1.00
R6521:Zfp407 UTSW 18 84,450,536 (GRCm39) missense probably damaging 1.00
R6748:Zfp407 UTSW 18 84,226,955 (GRCm39) missense probably damaging 0.98
R6882:Zfp407 UTSW 18 84,361,194 (GRCm39) splice site probably null
R6899:Zfp407 UTSW 18 84,579,559 (GRCm39) missense possibly damaging 0.86
R7038:Zfp407 UTSW 18 84,579,982 (GRCm39) missense probably damaging 1.00
R7076:Zfp407 UTSW 18 84,576,601 (GRCm39) missense probably damaging 1.00
R7326:Zfp407 UTSW 18 84,577,167 (GRCm39) missense possibly damaging 0.77
R7397:Zfp407 UTSW 18 84,579,944 (GRCm39) missense possibly damaging 0.59
R7402:Zfp407 UTSW 18 84,579,661 (GRCm39) missense probably benign 0.02
R7783:Zfp407 UTSW 18 84,228,047 (GRCm39) missense possibly damaging 0.69
R7800:Zfp407 UTSW 18 84,578,800 (GRCm39) missense probably damaging 0.99
R7904:Zfp407 UTSW 18 84,579,381 (GRCm39) missense not run
R7942:Zfp407 UTSW 18 84,577,754 (GRCm39) missense probably benign 0.02
R7955:Zfp407 UTSW 18 84,577,416 (GRCm39) missense probably benign 0.02
R7988:Zfp407 UTSW 18 84,577,525 (GRCm39) missense possibly damaging 0.60
R8125:Zfp407 UTSW 18 84,579,310 (GRCm39) missense probably damaging 1.00
R8237:Zfp407 UTSW 18 84,578,269 (GRCm39) missense possibly damaging 0.87
R8364:Zfp407 UTSW 18 84,570,993 (GRCm39) critical splice donor site probably null
R8443:Zfp407 UTSW 18 84,227,987 (GRCm39) missense probably damaging 1.00
R8487:Zfp407 UTSW 18 84,580,895 (GRCm39) nonsense probably null
R8497:Zfp407 UTSW 18 84,578,021 (GRCm39) missense probably damaging 0.98
R8808:Zfp407 UTSW 18 84,361,185 (GRCm39) missense probably benign 0.17
R8848:Zfp407 UTSW 18 84,578,819 (GRCm39) missense probably damaging 1.00
R8913:Zfp407 UTSW 18 84,578,653 (GRCm39) missense probably damaging 0.99
R8962:Zfp407 UTSW 18 84,577,057 (GRCm39) missense probably damaging 1.00
R9087:Zfp407 UTSW 18 84,227,982 (GRCm39) missense probably damaging 0.96
R9452:Zfp407 UTSW 18 84,580,579 (GRCm39) missense probably benign 0.02
R9691:Zfp407 UTSW 18 84,578,312 (GRCm39) missense probably benign 0.03
R9766:Zfp407 UTSW 18 84,577,574 (GRCm39) missense probably benign 0.06
RF003:Zfp407 UTSW 18 84,227,688 (GRCm39) missense probably benign 0.17
Z1177:Zfp407 UTSW 18 84,228,079 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTGTCACTGAATCAGGAGCACAGAG -3'
(R):5'- TCTGGAGATGGAGAGCTTAGCAGTC -3'

Sequencing Primer
(F):5'- CAGATGACTGGTGTGGATGT -3'
(R):5'- GAGAGCTTAGCAGTCAACTCTCTG -3'
Posted On 2013-09-30