Incidental Mutation 'R9154:Vmn2r51'
ID 695232
Institutional Source Beutler Lab
Gene Symbol Vmn2r51
Ensembl Gene ENSMUSG00000058685
Gene Name vomeronasal 2, receptor 51
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R9154 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 9821125-9839586 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 9839480 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 36 (D36V)
Ref Sequence ENSEMBL: ENSMUSP00000092459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094863]
AlphaFold L7N215
Predicted Effect probably damaging
Transcript: ENSMUST00000094863
AA Change: D36V

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092459
Gene: ENSMUSG00000058685
AA Change: D36V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.4e-31 PFAM
Pfam:NCD3G 512 565 8.1e-21 PFAM
Pfam:7tm_3 598 833 2.7e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T C 6: 91,926,926 (GRCm39) V862A probably benign Het
A2m A T 6: 121,645,512 (GRCm39) K1019M probably damaging Het
Acot6 G T 12: 84,147,789 (GRCm39) W15L possibly damaging Het
Adam32 CCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAG 8: 25,438,769 (GRCm39) probably benign Het
Adnp C A 2: 168,026,580 (GRCm39) Q238H possibly damaging Het
Akap7 T C 10: 25,047,053 (GRCm39) Y281C probably damaging Het
Ank1 A G 8: 23,605,387 (GRCm39) E1085G probably damaging Het
Arhgef38 A T 3: 132,837,924 (GRCm39) S669T unknown Het
Atp8b2 A T 3: 89,865,927 (GRCm39) S50R possibly damaging Het
Atp8b5 T C 4: 43,372,630 (GRCm39) I1090T probably benign Het
Ccdc198 A T 14: 49,473,367 (GRCm39) H129Q probably benign Het
Chrna4 G A 2: 180,670,602 (GRCm39) R385C probably damaging Het
Col4a1 T A 8: 11,267,446 (GRCm39) I1105F probably damaging Het
Crybg2 G A 4: 133,792,620 (GRCm39) R85Q probably benign Het
Cspg4 T A 9: 56,798,287 (GRCm39) L1434Q Het
Cyp3a13 T C 5: 137,919,758 (GRCm39) N6S probably benign Het
Dnase2b A T 3: 146,299,326 (GRCm39) Y42* probably null Het
F11r A G 1: 171,289,376 (GRCm39) E233G probably damaging Het
Fip1l1 T C 5: 74,747,703 (GRCm39) I390T possibly damaging Het
Fiz1 G A 7: 5,011,280 (GRCm39) R413C probably damaging Het
Fus G A 7: 127,580,440 (GRCm39) G450E unknown Het
Gm11569 C A 11: 99,689,267 (GRCm39) C144F unknown Het
Gm7298 A T 6: 121,756,436 (GRCm39) Y1027F probably damaging Het
Grik5 C A 7: 24,758,403 (GRCm39) W340L probably damaging Het
H1f2 A G 13: 23,923,373 (GRCm39) K181R unknown Het
Hectd4 G A 5: 121,391,967 (GRCm39) R77H Het
Ift81 C A 5: 122,689,122 (GRCm39) V665L probably benign Het
Ints2 A G 11: 86,125,524 (GRCm39) F559L probably damaging Het
Kdm8 G A 7: 125,054,296 (GRCm39) V176I probably benign Het
Keap1 A T 9: 21,142,121 (GRCm39) Y584* probably null Het
Klra1 T C 6: 130,357,607 (GRCm39) T7A Het
Lmo7 T A 14: 102,122,743 (GRCm39) W311R probably damaging Het
Lrp6 A G 6: 134,518,855 (GRCm39) V70A probably damaging Het
Luc7l3 A T 11: 94,190,793 (GRCm39) S174T unknown Het
Madd T C 2: 90,998,162 (GRCm39) T653A probably damaging Het
Mlph G T 1: 90,855,716 (GRCm39) G41V probably damaging Het
Mov10l1 A G 15: 88,896,118 (GRCm39) E654G possibly damaging Het
Mpp3 T C 11: 101,911,328 (GRCm39) I165V Het
Mrgpra2a T G 7: 47,076,394 (GRCm39) Y288S probably damaging Het
Mroh9 T A 1: 162,890,030 (GRCm39) M236L Het
Muc5b A C 7: 141,417,974 (GRCm39) K3640T probably damaging Het
Myh13 A G 11: 67,253,318 (GRCm39) I1485V probably benign Het
Nf2 A T 11: 4,744,873 (GRCm39) F285L probably damaging Het
Nfx1 T A 4: 40,990,845 (GRCm39) C471S probably damaging Het
Nsd1 C T 13: 55,361,253 (GRCm39) R74W probably damaging Het
Nudt16l1 A T 16: 4,758,281 (GRCm39) *212C probably null Het
Oaf T C 9: 43,133,992 (GRCm39) Y243C probably damaging Het
Or51e1 T C 7: 102,358,541 (GRCm39) V25A probably benign Het
Or6c3 T C 10: 129,308,690 (GRCm39) I43T probably benign Het
Or7g30 T A 9: 19,352,531 (GRCm39) F107L probably benign Het
Or7h8 A G 9: 20,124,173 (GRCm39) H176R possibly damaging Het
Or8b36 T A 9: 37,937,690 (GRCm39) L196* probably null Het
Parp9 T C 16: 35,768,543 (GRCm39) I241T probably damaging Het
Phlpp2 G T 8: 110,666,590 (GRCm39) A1040S possibly damaging Het
Pon2 A T 6: 5,265,391 (GRCm39) V332E possibly damaging Het
Ptprc A G 1: 138,016,302 (GRCm39) V544A probably damaging Het
Rfx6 A G 10: 51,597,600 (GRCm39) S446G probably benign Het
Rnf103 T A 6: 71,487,099 (GRCm39) C577S probably benign Het
Ros1 T G 10: 51,922,301 (GRCm39) E2278D possibly damaging Het
Rpl37 A G 15: 5,147,109 (GRCm39) S50G probably benign Het
Rrad C T 8: 105,355,343 (GRCm39) V222M possibly damaging Het
Ryr1 T C 7: 28,769,283 (GRCm39) T2770A probably benign Het
Secisbp2l G A 2: 125,617,623 (GRCm39) P18L probably damaging Het
Septin2 T A 1: 93,429,310 (GRCm39) W260R probably damaging Het
Slc35c2 A G 2: 165,122,797 (GRCm39) M117T probably benign Het
Slc44a5 A G 3: 153,953,373 (GRCm39) T252A probably benign Het
Speer4f2 T A 5: 17,581,610 (GRCm39) L184Q Het
Sphkap C G 1: 83,234,982 (GRCm39) V1615L probably damaging Het
Sult2a3 C T 7: 13,806,981 (GRCm39) V234I probably benign Het
Tanc1 T C 2: 59,630,132 (GRCm39) L704P probably damaging Het
Tas2r126 T C 6: 42,412,174 (GRCm39) S236P probably benign Het
Tnik A G 3: 28,704,235 (GRCm39) I1020V probably damaging Het
Tomm5 T C 4: 45,106,724 (GRCm39) Q64R unknown Het
Ttll13 A G 7: 79,897,182 (GRCm39) E16G probably benign Het
Vmn1r21 C A 6: 57,821,348 (GRCm39) C32F probably benign Het
Vmn2r63 C T 7: 42,576,413 (GRCm39) D467N probably damaging Het
Vwce A G 19: 10,625,850 (GRCm39) N454S possibly damaging Het
Wfdc1 A C 8: 120,406,116 (GRCm39) D77A Het
Yme1l1 T A 2: 23,077,815 (GRCm39) I419N probably damaging Het
Zfp106 G A 2: 120,364,812 (GRCm39) Q555* probably null Het
Zfp773 A C 7: 7,138,302 (GRCm39) M111R probably damaging Het
Zmat3 G A 3: 32,397,767 (GRCm39) A165V possibly damaging Het
Other mutations in Vmn2r51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Vmn2r51 APN 7 9,836,341 (GRCm39) missense probably benign
IGL01574:Vmn2r51 APN 7 9,836,381 (GRCm39) missense probably damaging 1.00
IGL01743:Vmn2r51 APN 7 9,834,154 (GRCm39) missense probably damaging 0.98
IGL01820:Vmn2r51 APN 7 9,839,409 (GRCm39) missense probably damaging 1.00
IGL02563:Vmn2r51 APN 7 9,834,243 (GRCm39) missense probably benign 0.00
IGL02825:Vmn2r51 APN 7 9,832,046 (GRCm39) splice site probably benign
IGL02834:Vmn2r51 APN 7 9,832,063 (GRCm39) nonsense probably null
R0617:Vmn2r51 UTSW 7 9,834,396 (GRCm39) missense possibly damaging 0.65
R0967:Vmn2r51 UTSW 7 9,834,012 (GRCm39) missense probably damaging 0.97
R1465:Vmn2r51 UTSW 7 9,834,249 (GRCm39) missense probably damaging 1.00
R1465:Vmn2r51 UTSW 7 9,834,249 (GRCm39) missense probably damaging 1.00
R1559:Vmn2r51 UTSW 7 9,836,373 (GRCm39) missense possibly damaging 0.87
R1559:Vmn2r51 UTSW 7 9,836,372 (GRCm39) missense possibly damaging 0.58
R1598:Vmn2r51 UTSW 7 9,839,432 (GRCm39) missense probably benign
R1754:Vmn2r51 UTSW 7 9,833,873 (GRCm39) missense probably benign 0.04
R1836:Vmn2r51 UTSW 7 9,832,091 (GRCm39) nonsense probably null
R1836:Vmn2r51 UTSW 7 9,832,090 (GRCm39) nonsense probably null
R3151:Vmn2r51 UTSW 7 9,833,968 (GRCm39) missense probably damaging 1.00
R4566:Vmn2r51 UTSW 7 9,836,341 (GRCm39) missense probably benign
R4933:Vmn2r51 UTSW 7 9,832,247 (GRCm39) missense probably damaging 1.00
R5004:Vmn2r51 UTSW 7 9,821,932 (GRCm39) missense probably benign
R5050:Vmn2r51 UTSW 7 9,834,349 (GRCm39) missense probably damaging 0.99
R5510:Vmn2r51 UTSW 7 9,836,545 (GRCm39) missense possibly damaging 0.95
R5559:Vmn2r51 UTSW 7 9,826,128 (GRCm39) missense probably damaging 1.00
R6127:Vmn2r51 UTSW 7 9,839,558 (GRCm39) missense probably damaging 1.00
R6154:Vmn2r51 UTSW 7 9,821,921 (GRCm39) missense possibly damaging 0.74
R6304:Vmn2r51 UTSW 7 9,832,164 (GRCm39) missense probably benign 0.00
R6370:Vmn2r51 UTSW 7 9,832,143 (GRCm39) missense probably damaging 1.00
R6471:Vmn2r51 UTSW 7 9,836,510 (GRCm39) missense possibly damaging 0.48
R6800:Vmn2r51 UTSW 7 9,832,191 (GRCm39) missense probably damaging 0.99
R6883:Vmn2r51 UTSW 7 9,834,025 (GRCm39) missense possibly damaging 0.75
R7191:Vmn2r51 UTSW 7 9,834,480 (GRCm39) missense probably null 1.00
R7246:Vmn2r51 UTSW 7 9,836,428 (GRCm39) missense probably benign 0.00
R8939:Vmn2r51 UTSW 7 9,833,953 (GRCm39) missense possibly damaging 0.85
R9428:Vmn2r51 UTSW 7 9,833,712 (GRCm39) critical splice donor site probably benign
R9451:Vmn2r51 UTSW 7 9,833,816 (GRCm39) missense probably damaging 1.00
R9729:Vmn2r51 UTSW 7 9,839,479 (GRCm39) missense probably benign 0.00
R9767:Vmn2r51 UTSW 7 9,839,407 (GRCm39) missense probably benign 0.09
Z1176:Vmn2r51 UTSW 7 9,833,835 (GRCm39) missense probably benign 0.12
Z1176:Vmn2r51 UTSW 7 9,821,984 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TCAGACTTAGCACCAGGACAG -3'
(R):5'- ATGCAATAAACCTCACCTTTGC -3'

Sequencing Primer
(F):5'- GACAGAAGACTCAAGAATTTGCC -3'
(R):5'- AGCTGGTAGAAATCTGATGTGC -3'
Posted On 2022-01-20