Incidental Mutation 'R9154:Phlpp2'
ID 695247
Institutional Source Beutler Lab
Gene Symbol Phlpp2
Ensembl Gene ENSMUSG00000031732
Gene Name PH domain and leucine rich repeat protein phosphatase 2
Synonyms C130044A18Rik, Phlppl
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.249) question?
Stock # R9154 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 110595174-110671303 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 110666590 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 1040 (A1040S)
Ref Sequence ENSEMBL: ENSMUSP00000136166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034175] [ENSMUST00000179721]
AlphaFold Q8BXA7
Predicted Effect possibly damaging
Transcript: ENSMUST00000034175
AA Change: A1005S

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034175
Gene: ENSMUSG00000031732
AA Change: A1005S

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Blast:PH 148 247 3e-61 BLAST
LRR 295 314 1.12e2 SMART
Pfam:LRR_7 319 335 3.5e-2 PFAM
LRR 341 363 2.82e0 SMART
LRR 364 387 9.75e0 SMART
LRR 456 479 2.68e1 SMART
LRR 498 517 1.35e1 SMART
LRR 521 540 5.59e1 SMART
LRR 544 563 2.79e1 SMART
LRR 569 589 1.62e1 SMART
LRR 590 609 1.67e1 SMART
LRR 616 641 1.33e2 SMART
LRR 640 659 1.4e1 SMART
LRR_TYP 664 687 6.78e-3 SMART
LRR 709 733 2.15e2 SMART
PP2Cc 772 1028 2.98e-30 SMART
low complexity region 1061 1095 N/A INTRINSIC
Blast:PP2Cc 1109 1175 8e-15 BLAST
low complexity region 1297 1315 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000179721
AA Change: A1040S

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136166
Gene: ENSMUSG00000031732
AA Change: A1040S

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 75 92 N/A INTRINSIC
Blast:PH 183 282 4e-61 BLAST
LRR 330 349 1.12e2 SMART
LRR 376 398 2.82e0 SMART
LRR 399 422 9.75e0 SMART
LRR 491 514 2.68e1 SMART
LRR 533 552 1.35e1 SMART
LRR 556 575 5.59e1 SMART
LRR 579 598 2.79e1 SMART
LRR 604 624 1.62e1 SMART
LRR 625 644 1.67e1 SMART
LRR 651 676 1.33e2 SMART
LRR 675 694 1.4e1 SMART
LRR_TYP 699 722 6.78e-3 SMART
LRR 744 768 2.15e2 SMART
PP2Cc 807 1063 2.98e-30 SMART
low complexity region 1096 1130 N/A INTRINSIC
Blast:PP2Cc 1144 1210 8e-15 BLAST
low complexity region 1332 1350 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T C 6: 91,926,926 (GRCm39) V862A probably benign Het
A2m A T 6: 121,645,512 (GRCm39) K1019M probably damaging Het
Acot6 G T 12: 84,147,789 (GRCm39) W15L possibly damaging Het
Adam32 CCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAG 8: 25,438,769 (GRCm39) probably benign Het
Adnp C A 2: 168,026,580 (GRCm39) Q238H possibly damaging Het
Akap7 T C 10: 25,047,053 (GRCm39) Y281C probably damaging Het
Ank1 A G 8: 23,605,387 (GRCm39) E1085G probably damaging Het
Arhgef38 A T 3: 132,837,924 (GRCm39) S669T unknown Het
Atp8b2 A T 3: 89,865,927 (GRCm39) S50R possibly damaging Het
Atp8b5 T C 4: 43,372,630 (GRCm39) I1090T probably benign Het
Ccdc198 A T 14: 49,473,367 (GRCm39) H129Q probably benign Het
Chrna4 G A 2: 180,670,602 (GRCm39) R385C probably damaging Het
Col4a1 T A 8: 11,267,446 (GRCm39) I1105F probably damaging Het
Crybg2 G A 4: 133,792,620 (GRCm39) R85Q probably benign Het
Cspg4 T A 9: 56,798,287 (GRCm39) L1434Q Het
Cyp3a13 T C 5: 137,919,758 (GRCm39) N6S probably benign Het
Dnase2b A T 3: 146,299,326 (GRCm39) Y42* probably null Het
F11r A G 1: 171,289,376 (GRCm39) E233G probably damaging Het
Fip1l1 T C 5: 74,747,703 (GRCm39) I390T possibly damaging Het
Fiz1 G A 7: 5,011,280 (GRCm39) R413C probably damaging Het
Fus G A 7: 127,580,440 (GRCm39) G450E unknown Het
Gm11569 C A 11: 99,689,267 (GRCm39) C144F unknown Het
Gm7298 A T 6: 121,756,436 (GRCm39) Y1027F probably damaging Het
Grik5 C A 7: 24,758,403 (GRCm39) W340L probably damaging Het
H1f2 A G 13: 23,923,373 (GRCm39) K181R unknown Het
Hectd4 G A 5: 121,391,967 (GRCm39) R77H Het
Ift81 C A 5: 122,689,122 (GRCm39) V665L probably benign Het
Ints2 A G 11: 86,125,524 (GRCm39) F559L probably damaging Het
Kdm8 G A 7: 125,054,296 (GRCm39) V176I probably benign Het
Keap1 A T 9: 21,142,121 (GRCm39) Y584* probably null Het
Klra1 T C 6: 130,357,607 (GRCm39) T7A Het
Lmo7 T A 14: 102,122,743 (GRCm39) W311R probably damaging Het
Lrp6 A G 6: 134,518,855 (GRCm39) V70A probably damaging Het
Luc7l3 A T 11: 94,190,793 (GRCm39) S174T unknown Het
Madd T C 2: 90,998,162 (GRCm39) T653A probably damaging Het
Mlph G T 1: 90,855,716 (GRCm39) G41V probably damaging Het
Mov10l1 A G 15: 88,896,118 (GRCm39) E654G possibly damaging Het
Mpp3 T C 11: 101,911,328 (GRCm39) I165V Het
Mrgpra2a T G 7: 47,076,394 (GRCm39) Y288S probably damaging Het
Mroh9 T A 1: 162,890,030 (GRCm39) M236L Het
Muc5b A C 7: 141,417,974 (GRCm39) K3640T probably damaging Het
Myh13 A G 11: 67,253,318 (GRCm39) I1485V probably benign Het
Nf2 A T 11: 4,744,873 (GRCm39) F285L probably damaging Het
Nfx1 T A 4: 40,990,845 (GRCm39) C471S probably damaging Het
Nsd1 C T 13: 55,361,253 (GRCm39) R74W probably damaging Het
Nudt16l1 A T 16: 4,758,281 (GRCm39) *212C probably null Het
Oaf T C 9: 43,133,992 (GRCm39) Y243C probably damaging Het
Or51e1 T C 7: 102,358,541 (GRCm39) V25A probably benign Het
Or6c3 T C 10: 129,308,690 (GRCm39) I43T probably benign Het
Or7g30 T A 9: 19,352,531 (GRCm39) F107L probably benign Het
Or7h8 A G 9: 20,124,173 (GRCm39) H176R possibly damaging Het
Or8b36 T A 9: 37,937,690 (GRCm39) L196* probably null Het
Parp9 T C 16: 35,768,543 (GRCm39) I241T probably damaging Het
Pon2 A T 6: 5,265,391 (GRCm39) V332E possibly damaging Het
Ptprc A G 1: 138,016,302 (GRCm39) V544A probably damaging Het
Rfx6 A G 10: 51,597,600 (GRCm39) S446G probably benign Het
Rnf103 T A 6: 71,487,099 (GRCm39) C577S probably benign Het
Ros1 T G 10: 51,922,301 (GRCm39) E2278D possibly damaging Het
Rpl37 A G 15: 5,147,109 (GRCm39) S50G probably benign Het
Rrad C T 8: 105,355,343 (GRCm39) V222M possibly damaging Het
Ryr1 T C 7: 28,769,283 (GRCm39) T2770A probably benign Het
Secisbp2l G A 2: 125,617,623 (GRCm39) P18L probably damaging Het
Septin2 T A 1: 93,429,310 (GRCm39) W260R probably damaging Het
Slc35c2 A G 2: 165,122,797 (GRCm39) M117T probably benign Het
Slc44a5 A G 3: 153,953,373 (GRCm39) T252A probably benign Het
Speer4f2 T A 5: 17,581,610 (GRCm39) L184Q Het
Sphkap C G 1: 83,234,982 (GRCm39) V1615L probably damaging Het
Sult2a3 C T 7: 13,806,981 (GRCm39) V234I probably benign Het
Tanc1 T C 2: 59,630,132 (GRCm39) L704P probably damaging Het
Tas2r126 T C 6: 42,412,174 (GRCm39) S236P probably benign Het
Tnik A G 3: 28,704,235 (GRCm39) I1020V probably damaging Het
Tomm5 T C 4: 45,106,724 (GRCm39) Q64R unknown Het
Ttll13 A G 7: 79,897,182 (GRCm39) E16G probably benign Het
Vmn1r21 C A 6: 57,821,348 (GRCm39) C32F probably benign Het
Vmn2r51 T A 7: 9,839,480 (GRCm39) D36V probably damaging Het
Vmn2r63 C T 7: 42,576,413 (GRCm39) D467N probably damaging Het
Vwce A G 19: 10,625,850 (GRCm39) N454S possibly damaging Het
Wfdc1 A C 8: 120,406,116 (GRCm39) D77A Het
Yme1l1 T A 2: 23,077,815 (GRCm39) I419N probably damaging Het
Zfp106 G A 2: 120,364,812 (GRCm39) Q555* probably null Het
Zfp773 A C 7: 7,138,302 (GRCm39) M111R probably damaging Het
Zmat3 G A 3: 32,397,767 (GRCm39) A165V possibly damaging Het
Other mutations in Phlpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Phlpp2 APN 8 110,652,422 (GRCm39) missense probably benign 0.01
IGL01363:Phlpp2 APN 8 110,663,729 (GRCm39) missense probably benign 0.22
IGL01535:Phlpp2 APN 8 110,660,697 (GRCm39) missense possibly damaging 0.82
IGL01815:Phlpp2 APN 8 110,666,491 (GRCm39) missense probably benign
IGL02105:Phlpp2 APN 8 110,631,040 (GRCm39) missense probably damaging 1.00
IGL02257:Phlpp2 APN 8 110,646,731 (GRCm39) missense possibly damaging 0.88
IGL02318:Phlpp2 APN 8 110,666,505 (GRCm39) missense probably benign 0.04
IGL02500:Phlpp2 APN 8 110,640,250 (GRCm39) missense probably benign
IGL03356:Phlpp2 APN 8 110,662,249 (GRCm39) missense probably benign 0.00
IGL03366:Phlpp2 APN 8 110,667,467 (GRCm39) missense probably benign 0.44
R0142:Phlpp2 UTSW 8 110,634,145 (GRCm39) missense probably damaging 1.00
R0144:Phlpp2 UTSW 8 110,634,145 (GRCm39) missense probably damaging 1.00
R0374:Phlpp2 UTSW 8 110,634,145 (GRCm39) missense probably damaging 1.00
R0420:Phlpp2 UTSW 8 110,666,567 (GRCm39) missense probably damaging 0.99
R0426:Phlpp2 UTSW 8 110,655,095 (GRCm39) missense probably benign 0.01
R0477:Phlpp2 UTSW 8 110,622,138 (GRCm39) critical splice acceptor site probably null
R0529:Phlpp2 UTSW 8 110,603,603 (GRCm39) missense probably benign 0.00
R0605:Phlpp2 UTSW 8 110,659,843 (GRCm39) missense probably benign 0.00
R0655:Phlpp2 UTSW 8 110,622,219 (GRCm39) missense probably benign 0.00
R0833:Phlpp2 UTSW 8 110,663,738 (GRCm39) missense probably damaging 1.00
R0836:Phlpp2 UTSW 8 110,663,738 (GRCm39) missense probably damaging 1.00
R1394:Phlpp2 UTSW 8 110,603,662 (GRCm39) nonsense probably null
R1417:Phlpp2 UTSW 8 110,667,313 (GRCm39) nonsense probably null
R1602:Phlpp2 UTSW 8 110,660,655 (GRCm39) missense possibly damaging 0.96
R1650:Phlpp2 UTSW 8 110,660,587 (GRCm39) splice site probably benign
R1815:Phlpp2 UTSW 8 110,666,855 (GRCm39) missense probably damaging 1.00
R2045:Phlpp2 UTSW 8 110,634,232 (GRCm39) missense probably damaging 1.00
R2072:Phlpp2 UTSW 8 110,655,124 (GRCm39) missense possibly damaging 0.88
R2074:Phlpp2 UTSW 8 110,655,124 (GRCm39) missense possibly damaging 0.88
R2075:Phlpp2 UTSW 8 110,655,124 (GRCm39) missense possibly damaging 0.88
R2433:Phlpp2 UTSW 8 110,666,634 (GRCm39) missense probably damaging 1.00
R3028:Phlpp2 UTSW 8 110,634,245 (GRCm39) missense probably damaging 1.00
R4611:Phlpp2 UTSW 8 110,603,515 (GRCm39) missense possibly damaging 0.79
R4718:Phlpp2 UTSW 8 110,667,452 (GRCm39) missense probably benign 0.31
R4739:Phlpp2 UTSW 8 110,667,052 (GRCm39) missense probably damaging 1.00
R4857:Phlpp2 UTSW 8 110,603,642 (GRCm39) missense probably damaging 1.00
R5020:Phlpp2 UTSW 8 110,666,714 (GRCm39) missense probably damaging 1.00
R5047:Phlpp2 UTSW 8 110,640,251 (GRCm39) missense probably benign 0.04
R5074:Phlpp2 UTSW 8 110,652,461 (GRCm39) missense probably damaging 0.99
R5330:Phlpp2 UTSW 8 110,660,667 (GRCm39) missense probably damaging 0.99
R5663:Phlpp2 UTSW 8 110,630,976 (GRCm39) missense probably benign 0.01
R5668:Phlpp2 UTSW 8 110,655,205 (GRCm39) missense possibly damaging 0.67
R6433:Phlpp2 UTSW 8 110,661,317 (GRCm39) missense probably benign
R6470:Phlpp2 UTSW 8 110,663,826 (GRCm39) missense probably benign 0.45
R6804:Phlpp2 UTSW 8 110,655,197 (GRCm39) missense probably damaging 1.00
R7012:Phlpp2 UTSW 8 110,603,486 (GRCm39) missense possibly damaging 0.95
R7183:Phlpp2 UTSW 8 110,666,585 (GRCm39) missense probably damaging 1.00
R7257:Phlpp2 UTSW 8 110,666,820 (GRCm39) missense probably benign
R7312:Phlpp2 UTSW 8 110,666,785 (GRCm39) missense probably damaging 0.96
R7349:Phlpp2 UTSW 8 110,655,278 (GRCm39) missense probably damaging 0.98
R7801:Phlpp2 UTSW 8 110,652,474 (GRCm39) missense possibly damaging 0.56
R8059:Phlpp2 UTSW 8 110,622,189 (GRCm39) missense probably benign 0.00
R8174:Phlpp2 UTSW 8 110,595,321 (GRCm39) missense unknown
R8242:Phlpp2 UTSW 8 110,666,834 (GRCm39) missense probably benign 0.03
R8488:Phlpp2 UTSW 8 110,640,202 (GRCm39) missense probably benign
R8688:Phlpp2 UTSW 8 110,631,012 (GRCm39) missense probably damaging 1.00
R8843:Phlpp2 UTSW 8 110,652,431 (GRCm39) missense probably benign 0.18
R9556:Phlpp2 UTSW 8 110,666,758 (GRCm39) missense probably benign
R9737:Phlpp2 UTSW 8 110,663,714 (GRCm39) missense probably damaging 0.99
R9781:Phlpp2 UTSW 8 110,662,178 (GRCm39) missense possibly damaging 0.95
R9786:Phlpp2 UTSW 8 110,660,655 (GRCm39) nonsense probably null
X0018:Phlpp2 UTSW 8 110,639,001 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAACGGAGTAACCTGCTG -3'
(R):5'- TGCTGAACTCGGAGGCAATC -3'

Sequencing Primer
(F):5'- AGTAACCTGCTGCACCCG -3'
(R):5'- GAGGCAATCCCACTACTGGAG -3'
Posted On 2022-01-20