Incidental Mutation 'R9155:Itga8'
ID 695280
Institutional Source Beutler Lab
Gene Symbol Itga8
Ensembl Gene ENSMUSG00000026768
Gene Name integrin alpha 8
Synonyms
MMRRC Submission 068941-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.870) question?
Stock # R9155 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 12111443-12306733 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 12194330 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 690 (I690T)
Ref Sequence ENSEMBL: ENSMUSP00000028106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]
AlphaFold A2ARA8
Predicted Effect probably benign
Transcript: ENSMUST00000028106
AA Change: I690T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: I690T

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
SCOP:d1m1xa2 643 780 2e-46 SMART
SCOP:d1m1xa3 784 1000 2e-80 SMART
transmembrane domain 1011 1033 N/A INTRINSIC
Pfam:Integrin_alpha 1034 1048 2.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129370
Predicted Effect probably benign
Transcript: ENSMUST00000172791
SMART Domains Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A G 5: 107,691,811 (GRCm39) E34G probably damaging Het
Aldh1a3 A T 7: 66,058,867 (GRCm39) L157* probably null Het
Asic2 T A 11: 80,784,872 (GRCm39) T356S probably benign Het
Ate1 T C 7: 129,996,463 (GRCm39) D459G probably damaging Het
Cacna1g T A 11: 94,350,423 (GRCm39) Q474L Het
Calhm6 T C 10: 34,002,363 (GRCm39) E240G probably damaging Het
Carf C A 1: 60,189,842 (GRCm39) T689K possibly damaging Het
Carmil2 A G 8: 106,412,922 (GRCm39) D6G probably benign Het
Ccnd2 A C 6: 127,127,663 (GRCm39) V25G probably damaging Het
Ccnk T A 12: 108,159,978 (GRCm39) F153L probably damaging Het
Cdh23 C T 10: 60,249,485 (GRCm39) G808E probably damaging Het
Clec11a C T 7: 43,954,317 (GRCm39) R212Q probably damaging Het
Cog4 T C 8: 111,608,384 (GRCm39) W749R probably damaging Het
Col6a3 T A 1: 90,738,301 (GRCm39) T1073S probably benign Het
Col6a4 T A 9: 105,952,209 (GRCm39) D563V probably benign Het
Coq5 A G 5: 115,433,839 (GRCm39) probably null Het
Crebbp A C 16: 3,914,346 (GRCm39) H1292Q probably damaging Het
Csmd3 C A 15: 47,449,051 (GRCm39) G2737W Het
Ddrgk1 T C 2: 130,500,227 (GRCm39) Y223C probably damaging Het
Dennd1c T C 17: 57,373,796 (GRCm39) Q589R probably benign Het
Dnah10 A G 5: 124,907,475 (GRCm39) D4336G probably damaging Het
Dnah11 C T 12: 117,991,251 (GRCm39) E2372K probably damaging Het
E330034G19Rik A T 14: 24,346,938 (GRCm39) Q140L possibly damaging Het
Ergic3 A G 2: 155,850,780 (GRCm39) Y83C probably damaging Het
Fam171a2 A T 11: 102,329,497 (GRCm39) S421T probably benign Het
Fndc3a T A 14: 72,921,162 (GRCm39) H4L possibly damaging Het
Gid8 T A 2: 180,359,756 (GRCm39) Y213* probably null Het
Hephl1 G T 9: 15,000,375 (GRCm39) H292Q probably damaging Het
Hexb T C 13: 97,314,414 (GRCm39) Y443C probably damaging Het
Htr1f C T 16: 64,746,788 (GRCm39) R168H probably benign Het
Hus1 A G 11: 8,956,056 (GRCm39) I159T probably damaging Het
Inha A G 1: 75,486,133 (GRCm39) T143A probably benign Het
Itgae G T 11: 73,016,089 (GRCm39) C766F possibly damaging Het
Kank4 T C 4: 98,666,563 (GRCm39) E628G probably benign Het
Kctd19 T C 8: 106,120,571 (GRCm39) H221R probably benign Het
Llgl1 A G 11: 60,597,934 (GRCm39) E351G probably benign Het
Lrba A G 3: 86,202,508 (GRCm39) Y253C probably damaging Het
Lrp2 T A 2: 69,291,713 (GRCm39) R3489* probably null Het
Lrriq1 T C 10: 103,050,640 (GRCm39) N704S probably benign Het
Mbtps1 T C 8: 120,235,693 (GRCm39) N995S probably benign Het
Mga T C 2: 119,757,013 (GRCm39) C1077R probably damaging Het
Muc21 G A 17: 35,932,131 (GRCm39) P685L unknown Het
Ndufv1 A T 19: 4,059,912 (GRCm39) C142S probably damaging Het
Nkx3-1 T C 14: 69,429,660 (GRCm39) L226P probably damaging Het
Nsd1 C T 13: 55,361,253 (GRCm39) R74W probably damaging Het
Or12k8 A C 2: 36,975,016 (GRCm39) M248R probably benign Het
Or1d2 A G 11: 74,255,791 (GRCm39) T99A probably benign Het
Or2n1d A T 17: 38,646,224 (GRCm39) M59L probably damaging Het
Or5b99 G A 19: 12,976,428 (GRCm39) C26Y probably benign Het
Or7g35 A T 9: 19,496,379 (GRCm39) D182V probably benign Het
Phc3 A G 3: 30,968,691 (GRCm39) V812A probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,341,589 (GRCm39) probably null Het
Ppp4c A T 7: 126,386,419 (GRCm39) C193S possibly damaging Het
Rbbp5 C A 1: 132,422,023 (GRCm39) P308T probably damaging Het
Rhot1 A G 11: 80,148,380 (GRCm39) T607A probably null Het
Secisbp2l G A 2: 125,617,623 (GRCm39) P18L probably damaging Het
Slc27a4 G A 2: 29,701,294 (GRCm39) G362S probably damaging Het
Slc4a8 T C 15: 100,672,571 (GRCm39) Y36H probably damaging Het
Sox17 T C 1: 4,562,447 (GRCm39) Y251C probably damaging Het
Spata31h1 A T 10: 82,120,203 (GRCm39) I4269N probably damaging Het
Taf4b T C 18: 14,946,296 (GRCm39) V373A probably benign Het
Tecpr2 T A 12: 110,881,184 (GRCm39) V107E probably damaging Het
Them7 A G 2: 105,209,124 (GRCm39) Y148C probably damaging Het
Tktl2 T A 8: 66,965,858 (GRCm39) M472K possibly damaging Het
Ttn C T 2: 76,625,937 (GRCm39) V15041I probably damaging Het
Ubr1 A G 2: 120,754,615 (GRCm39) V751A possibly damaging Het
Vmn1r213 A T 13: 23,196,343 (GRCm39) R309* probably null Het
Vmn2r10 A T 5: 109,144,212 (GRCm39) D579E probably benign Het
Vmn2r118 T C 17: 55,917,207 (GRCm39) Q435R probably null Het
Vmn2r50 A T 7: 9,781,571 (GRCm39) H391Q probably damaging Het
Zbtb44 A T 9: 30,965,309 (GRCm39) I240F probably benign Het
Other mutations in Itga8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Itga8 APN 2 12,260,777 (GRCm39) nonsense probably null
IGL00820:Itga8 APN 2 12,237,703 (GRCm39) missense possibly damaging 0.85
IGL01409:Itga8 APN 2 12,196,525 (GRCm39) missense probably benign
IGL01508:Itga8 APN 2 12,237,613 (GRCm39) missense possibly damaging 0.67
IGL01585:Itga8 APN 2 12,165,123 (GRCm39) splice site probably benign
IGL01590:Itga8 APN 2 12,165,144 (GRCm39) missense probably damaging 1.00
IGL01743:Itga8 APN 2 12,270,144 (GRCm39) missense probably benign 0.04
IGL02634:Itga8 APN 2 12,145,289 (GRCm39) missense possibly damaging 0.55
IGL02805:Itga8 APN 2 12,194,291 (GRCm39) missense possibly damaging 0.83
IGL03200:Itga8 APN 2 12,196,010 (GRCm39) missense probably benign 0.00
IGL03218:Itga8 APN 2 12,115,836 (GRCm39) missense possibly damaging 0.77
IGL03248:Itga8 APN 2 12,137,327 (GRCm39) missense probably benign 0.20
PIT4576001:Itga8 UTSW 2 12,234,903 (GRCm39) missense probably benign 0.19
R0196:Itga8 UTSW 2 12,209,540 (GRCm39) critical splice donor site probably null
R0356:Itga8 UTSW 2 12,187,532 (GRCm39) missense possibly damaging 0.73
R0466:Itga8 UTSW 2 12,237,697 (GRCm39) missense probably damaging 1.00
R0530:Itga8 UTSW 2 12,196,627 (GRCm39) missense probably damaging 0.99
R0715:Itga8 UTSW 2 12,196,053 (GRCm39) splice site probably benign
R0800:Itga8 UTSW 2 12,198,362 (GRCm39) missense possibly damaging 0.95
R0881:Itga8 UTSW 2 12,267,003 (GRCm39) splice site probably null
R1675:Itga8 UTSW 2 12,204,974 (GRCm39) missense probably damaging 0.99
R1758:Itga8 UTSW 2 12,270,144 (GRCm39) missense possibly damaging 0.83
R1939:Itga8 UTSW 2 12,305,657 (GRCm39) missense probably damaging 1.00
R2187:Itga8 UTSW 2 12,199,231 (GRCm39) missense possibly damaging 0.60
R2295:Itga8 UTSW 2 12,187,520 (GRCm39) missense probably benign 0.38
R2356:Itga8 UTSW 2 12,204,952 (GRCm39) missense probably benign
R2371:Itga8 UTSW 2 12,258,277 (GRCm39) missense probably damaging 1.00
R2412:Itga8 UTSW 2 12,306,526 (GRCm39) missense probably benign
R2440:Itga8 UTSW 2 12,183,491 (GRCm39) missense possibly damaging 0.70
R2848:Itga8 UTSW 2 12,165,215 (GRCm39) missense probably damaging 0.98
R3730:Itga8 UTSW 2 12,198,321 (GRCm39) missense possibly damaging 0.92
R3933:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R3982:Itga8 UTSW 2 12,305,774 (GRCm39) missense possibly damaging 0.92
R4513:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4514:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4660:Itga8 UTSW 2 12,270,069 (GRCm39) missense probably damaging 1.00
R4890:Itga8 UTSW 2 12,198,102 (GRCm39) splice site probably benign
R5533:Itga8 UTSW 2 12,165,161 (GRCm39) missense possibly damaging 0.90
R5619:Itga8 UTSW 2 12,270,139 (GRCm39) missense probably damaging 1.00
R5720:Itga8 UTSW 2 12,115,898 (GRCm39) missense probably damaging 0.99
R5749:Itga8 UTSW 2 12,266,889 (GRCm39) missense probably damaging 1.00
R5930:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R5954:Itga8 UTSW 2 12,137,297 (GRCm39) missense probably damaging 0.99
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6211:Itga8 UTSW 2 12,198,320 (GRCm39) missense probably damaging 1.00
R6337:Itga8 UTSW 2 12,258,280 (GRCm39) nonsense probably null
R6442:Itga8 UTSW 2 12,234,954 (GRCm39) missense probably benign 0.00
R6491:Itga8 UTSW 2 12,209,587 (GRCm39) missense probably damaging 1.00
R6543:Itga8 UTSW 2 12,306,455 (GRCm39) missense probably damaging 0.99
R6574:Itga8 UTSW 2 12,234,972 (GRCm39) missense probably benign 0.17
R6760:Itga8 UTSW 2 12,306,451 (GRCm39) missense probably damaging 1.00
R6858:Itga8 UTSW 2 12,204,892 (GRCm39) missense probably benign 0.00
R6943:Itga8 UTSW 2 12,160,182 (GRCm39) critical splice donor site probably null
R7048:Itga8 UTSW 2 12,115,895 (GRCm39) missense probably damaging 0.99
R7203:Itga8 UTSW 2 12,234,906 (GRCm39) missense possibly damaging 0.77
R7266:Itga8 UTSW 2 12,237,712 (GRCm39) missense probably damaging 1.00
R7323:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R7540:Itga8 UTSW 2 12,115,848 (GRCm39) missense possibly damaging 0.82
R7637:Itga8 UTSW 2 12,113,998 (GRCm39) missense probably damaging 1.00
R7748:Itga8 UTSW 2 12,235,050 (GRCm39) missense possibly damaging 0.80
R7848:Itga8 UTSW 2 12,196,548 (GRCm39) missense probably damaging 0.99
R8031:Itga8 UTSW 2 12,160,297 (GRCm39) missense probably benign
R8077:Itga8 UTSW 2 12,247,244 (GRCm39) missense probably benign 0.09
R8757:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8759:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8772:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8773:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8808:Itga8 UTSW 2 12,137,328 (GRCm39) nonsense probably null
R8898:Itga8 UTSW 2 12,145,206 (GRCm39) missense probably benign 0.05
R8962:Itga8 UTSW 2 12,196,045 (GRCm39) missense possibly damaging 0.94
R9056:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R9354:Itga8 UTSW 2 12,237,668 (GRCm39) missense possibly damaging 0.94
R9563:Itga8 UTSW 2 12,165,219 (GRCm39) missense possibly damaging 0.83
R9589:Itga8 UTSW 2 12,237,701 (GRCm39) missense probably damaging 1.00
R9663:Itga8 UTSW 2 12,196,580 (GRCm39) missense probably benign 0.00
Z1176:Itga8 UTSW 2 12,306,643 (GRCm39) start gained probably benign
Z1176:Itga8 UTSW 2 12,266,947 (GRCm39) missense probably benign 0.01
Z1176:Itga8 UTSW 2 12,252,329 (GRCm39) missense probably damaging 1.00
Z1177:Itga8 UTSW 2 12,305,744 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGCCATCTTTGTACTGTGCC -3'
(R):5'- CTAAATCACTGTATTTCTTGGTCGG -3'

Sequencing Primer
(F):5'- ACTGTGCCTGAGAGAGACTTTAC -3'
(R):5'- TGAGACAGACTCCTGCTATGTAGC -3'
Posted On 2022-01-20