Mutagenetix > Incidental Mutation

Incidental Mutation 'R9155:Itga8'

695280

Institutional Source

Beutler Lab

Gene Symbol

Itga8

Ensembl Gene

ENSMUSG00000026768

Gene Name

integrin alpha 8

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.898) question?

Stock #

R9155 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

12106632-12301922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12189519 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 690 (I690T)

Ref Sequence

ENSEMBL: ENSMUSP00000028106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]

AlphaFold

A2ARA8

Predicted Effect

probably benign
Transcript: ENSMUST00000028106
AA Change: I690T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: I690T

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART
SCOP:d1m1xa2	643	780	2e-46	SMART
SCOP:d1m1xa3	784	1000	2e-80	SMART
transmembrane domain	1011	1033	N/A	INTRINSIC
Pfam:Integrin_alpha	1034	1048	2.5e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129370

Predicted Effect

probably benign
Transcript: ENSMUST00000172791

SMART Domains

Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028K03Rik	A	G	5: 107,543,945	E34G	probably damaging	Het
4932415D10Rik	A	T	10: 82,284,369	I4269N	probably damaging	Het
Aldh1a3	A	T	7: 66,409,119	L157*	probably null	Het
Asic2	T	A	11: 80,894,046	T356S	probably benign	Het
Ate1	T	C	7: 130,394,733	D459G	probably damaging	Het
Cacna1g	T	A	11: 94,459,597	Q474L		Het
Carf	C	A	1: 60,150,683	T689K	possibly damaging	Het
Carmil2	A	G	8: 105,686,290	D6G	probably benign	Het
Ccnd2	A	C	6: 127,150,700	V25G	probably damaging	Het
Ccnk	T	A	12: 108,193,719	F153L	probably damaging	Het
Cdh23	C	T	10: 60,413,706	G808E	probably damaging	Het
Clec11a	C	T	7: 44,304,893	R212Q	probably damaging	Het
Cog4	T	C	8: 110,881,752	W749R	probably damaging	Het
Col6a3	T	A	1: 90,810,579	T1073S	probably benign	Het
Col6a4	T	A	9: 106,075,010	D563V	probably benign	Het
Coq5	A	G	5: 115,295,780		probably null	Het
Crebbp	A	C	16: 4,096,482	H1292Q	probably damaging	Het
Csmd3	C	A	15: 47,585,655	G2737W		Het
Ddrgk1	T	C	2: 130,658,307	Y223C	probably damaging	Het
Dennd1c	T	C	17: 57,066,796	Q589R	probably benign	Het
Dnah10	A	G	5: 124,830,411	D4336G	probably damaging	Het
Dnah11	C	T	12: 118,027,516	E2372K	probably damaging	Het
E330034G19Rik	A	T	14: 24,296,870	Q140L	possibly damaging	Het
Ergic3	A	G	2: 156,008,860	Y83C	probably damaging	Het
Fam171a2	A	T	11: 102,438,671	S421T	probably benign	Het
Fam26f	T	C	10: 34,126,367	E240G	probably damaging	Het
Fndc3a	T	A	14: 72,683,722	H4L	possibly damaging	Het
Gid8	T	A	2: 180,717,963	Y213*	probably null	Het
Gm9573	G	A	17: 35,621,239	P685L	unknown	Het
Hephl1	G	T	9: 15,089,079	H292Q	probably damaging	Het
Hexb	T	C	13: 97,177,906	Y443C	probably damaging	Het
Htr1f	C	T	16: 64,926,425	R168H	probably benign	Het
Hus1	A	G	11: 9,006,056	I159T	probably damaging	Het
Inha	A	G	1: 75,509,489	T143A	probably benign	Het
Itgae	G	T	11: 73,125,263	C766F	possibly damaging	Het
Kank4	T	C	4: 98,778,326	E628G	probably benign	Het
Kctd19	T	C	8: 105,393,939	H221R	probably benign	Het
Llgl1	A	G	11: 60,707,108	E351G	probably benign	Het
Lrba	A	G	3: 86,295,201	Y253C	probably damaging	Het
Lrp2	T	A	2: 69,461,369	R3489*	probably null	Het
Lrriq1	T	C	10: 103,214,779	N704S	probably benign	Het
Mbtps1	T	C	8: 119,508,954	N995S	probably benign	Het
Mga	T	C	2: 119,926,532	C1077R	probably damaging	Het
Ndufv1	A	T	19: 4,009,912	C142S	probably damaging	Het
Nkx3-1	T	C	14: 69,192,211	L226P	probably damaging	Het
Nsd1	C	T	13: 55,213,440	R74W	probably damaging	Het
Olfr136	A	T	17: 38,335,333	M59L	probably damaging	Het
Olfr1451	G	A	19: 12,999,064	C26Y	probably benign	Het
Olfr361	A	C	2: 37,085,004	M248R	probably benign	Het
Olfr412	A	G	11: 74,364,965	T99A	probably benign	Het
Olfr855	A	T	9: 19,585,083	D182V	probably benign	Het
Phc3	A	G	3: 30,914,542	V812A	probably benign	Het
Pigt	CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT	CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT	2: 164,499,669		probably null	Het
Ppp4c	A	T	7: 126,787,247	C193S	possibly damaging	Het
Rbbp5	C	A	1: 132,494,285	P308T	probably damaging	Het
Rhot1	A	G	11: 80,257,554	T607A	probably null	Het
Secisbp2l	G	A	2: 125,775,703	P18L	probably damaging	Het
Slc27a4	G	A	2: 29,811,282	G362S	probably damaging	Het
Slc4a8	T	C	15: 100,774,690	Y36H	probably damaging	Het
Sox17	T	C	1: 4,492,224	Y251C	probably damaging	Het
Taf4b	T	C	18: 14,813,239	V373A	probably benign	Het
Tecpr2	T	A	12: 110,914,750	V107E	probably damaging	Het
Them7	A	G	2: 105,378,779	Y148C	probably damaging	Het
Tktl2	T	A	8: 66,513,206	M472K	possibly damaging	Het
Ttn	C	T	2: 76,795,593	V15041I	probably damaging	Het
Ubr1	A	G	2: 120,924,134	V751A	possibly damaging	Het
Vmn1r213	A	T	13: 23,012,173	R309*	probably null	Het
Vmn2r10	A	T	5: 108,996,346	D579E	probably benign	Het
Vmn2r118	T	C	17: 55,610,207	Q435R	probably null	Het
Vmn2r50	A	T	7: 10,047,644	H391Q	probably damaging	Het
Zbtb44	A	T	9: 31,054,013	I240F	probably benign	Het

Other mutations in Itga8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00806:Itga8	APN	2	12255966	nonsense	probably null
IGL00820:Itga8	APN	2	12232892	missense	possibly damaging	0.85
IGL01409:Itga8	APN	2	12191714	missense	probably benign
IGL01508:Itga8	APN	2	12232802	missense	possibly damaging	0.67
IGL01585:Itga8	APN	2	12160312	splice site	probably benign
IGL01590:Itga8	APN	2	12160333	missense	probably damaging	1.00
IGL01743:Itga8	APN	2	12265333	missense	probably benign	0.04
IGL02634:Itga8	APN	2	12140478	missense	possibly damaging	0.55
IGL02805:Itga8	APN	2	12189480	missense	possibly damaging	0.83
IGL03200:Itga8	APN	2	12191199	missense	probably benign	0.00
IGL03218:Itga8	APN	2	12111025	missense	possibly damaging	0.77
IGL03248:Itga8	APN	2	12132516	missense	probably benign	0.20
PIT4576001:Itga8	UTSW	2	12230092	missense	probably benign	0.19
R0196:Itga8	UTSW	2	12204729	critical splice donor site	probably null
R0356:Itga8	UTSW	2	12182721	missense	possibly damaging	0.73
R0466:Itga8	UTSW	2	12232886	missense	probably damaging	1.00
R0530:Itga8	UTSW	2	12191816	missense	probably damaging	0.99
R0715:Itga8	UTSW	2	12191242	splice site	probably benign
R0800:Itga8	UTSW	2	12193551	missense	possibly damaging	0.95
R0881:Itga8	UTSW	2	12262192	splice site	probably null
R1675:Itga8	UTSW	2	12200163	missense	probably damaging	0.99
R1758:Itga8	UTSW	2	12265333	missense	possibly damaging	0.83
R1939:Itga8	UTSW	2	12300846	missense	probably damaging	1.00
R2187:Itga8	UTSW	2	12194420	missense	possibly damaging	0.60
R2295:Itga8	UTSW	2	12182709	missense	probably benign	0.38
R2356:Itga8	UTSW	2	12200141	missense	probably benign
R2371:Itga8	UTSW	2	12253466	missense	probably damaging	1.00
R2412:Itga8	UTSW	2	12301715	missense	probably benign
R2440:Itga8	UTSW	2	12178680	missense	possibly damaging	0.70
R2848:Itga8	UTSW	2	12160404	missense	probably damaging	0.98
R3730:Itga8	UTSW	2	12193510	missense	possibly damaging	0.92
R3933:Itga8	UTSW	2	12189519	missense	probably benign
R3982:Itga8	UTSW	2	12300963	missense	possibly damaging	0.92
R4513:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4514:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4660:Itga8	UTSW	2	12265258	missense	probably damaging	1.00
R4890:Itga8	UTSW	2	12193291	splice site	probably benign
R5533:Itga8	UTSW	2	12160350	missense	possibly damaging	0.90
R5619:Itga8	UTSW	2	12265328	missense	probably damaging	1.00
R5720:Itga8	UTSW	2	12111087	missense	probably damaging	0.99
R5749:Itga8	UTSW	2	12262078	missense	probably damaging	1.00
R5930:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R5954:Itga8	UTSW	2	12132486	missense	probably damaging	0.99
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6211:Itga8	UTSW	2	12193509	missense	probably damaging	1.00
R6337:Itga8	UTSW	2	12253469	nonsense	probably null
R6442:Itga8	UTSW	2	12230143	missense	probably benign	0.00
R6491:Itga8	UTSW	2	12204776	missense	probably damaging	1.00
R6543:Itga8	UTSW	2	12301644	missense	probably damaging	0.99
R6574:Itga8	UTSW	2	12230161	missense	probably benign	0.17
R6760:Itga8	UTSW	2	12301640	missense	probably damaging	1.00
R6858:Itga8	UTSW	2	12200081	missense	probably benign	0.00
R6943:Itga8	UTSW	2	12155371	critical splice donor site	probably null
R7048:Itga8	UTSW	2	12111084	missense	probably damaging	0.99
R7203:Itga8	UTSW	2	12230095	missense	possibly damaging	0.77
R7266:Itga8	UTSW	2	12232901	missense	probably damaging	1.00
R7323:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R7540:Itga8	UTSW	2	12111037	missense	possibly damaging	0.82
R7637:Itga8	UTSW	2	12109187	missense	probably damaging	1.00
R7748:Itga8	UTSW	2	12230239	missense	possibly damaging	0.80
R7848:Itga8	UTSW	2	12191737	missense	probably damaging	0.99
R8031:Itga8	UTSW	2	12155486	missense	probably benign
R8077:Itga8	UTSW	2	12242433	missense	probably benign	0.09
R8757:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8759:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8772:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8773:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8808:Itga8	UTSW	2	12132517	nonsense	probably null
R8898:Itga8	UTSW	2	12140395	missense	probably benign	0.05
R8962:Itga8	UTSW	2	12191234	missense	possibly damaging	0.94
R9056:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R9354:Itga8	UTSW	2	12232857	missense	possibly damaging	0.94
R9563:Itga8	UTSW	2	12160408	missense	possibly damaging	0.83
R9589:Itga8	UTSW	2	12232890	missense	probably damaging	1.00
R9663:Itga8	UTSW	2	12191769	missense	probably benign	0.00
Z1176:Itga8	UTSW	2	12247518	missense	probably damaging	1.00
Z1176:Itga8	UTSW	2	12262136	missense	probably benign	0.01
Z1176:Itga8	UTSW	2	12301832	start gained	probably benign
Z1177:Itga8	UTSW	2	12300933	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GGCCATCTTTGTACTGTGCC -3'
(R):5'- CTAAATCACTGTATTTCTTGGTCGG -3'

Sequencing Primer
(F):5'- ACTGTGCCTGAGAGAGACTTTAC -3'
(R):5'- TGAGACAGACTCCTGCTATGTAGC -3'

Posted On

2022-01-20