Incidental Mutation 'R9155:Ate1'
ID 695305
Institutional Source Beutler Lab
Gene Symbol Ate1
Ensembl Gene ENSMUSG00000030850
Gene Name arginyltransferase 1
Synonyms
MMRRC Submission 068941-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9155 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 130391493-130520369 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 130394733 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 459 (D459G)
Ref Sequence ENSEMBL: ENSMUSP00000043365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033139] [ENSMUST00000035458] [ENSMUST00000094017] [ENSMUST00000124096] [ENSMUST00000178534] [ENSMUST00000216011]
AlphaFold Q9Z2A5
Predicted Effect
SMART Domains Protein: ENSMUSP00000033139
Gene: ENSMUSG00000030850
AA Change: D459G

DomainStartEndE-ValueType
Pfam:ATE_N 18 92 1.2e-32 PFAM
low complexity region 147 168 N/A INTRINSIC
low complexity region 224 236 N/A INTRINSIC
Pfam:ATE_C 288 430 4.3e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000035458
AA Change: D459G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043365
Gene: ENSMUSG00000030850
AA Change: D459G

DomainStartEndE-ValueType
Pfam:ATE_N 14 92 2.3e-30 PFAM
low complexity region 147 168 N/A INTRINSIC
low complexity region 224 236 N/A INTRINSIC
Pfam:ATE_C 287 431 6.6e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094017
AA Change: D452G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091556
Gene: ENSMUSG00000030850
AA Change: D452G

DomainStartEndE-ValueType
Pfam:ATE_N 7 85 3.3e-29 PFAM
low complexity region 140 161 N/A INTRINSIC
low complexity region 217 229 N/A INTRINSIC
Pfam:ATE_C 280 424 2.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178534
AA Change: D452G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136956
Gene: ENSMUSG00000030850
AA Change: D452G

DomainStartEndE-ValueType
Pfam:ATE_N 7 85 3.3e-29 PFAM
low complexity region 140 161 N/A INTRINSIC
low complexity region 217 229 N/A INTRINSIC
Pfam:ATE_C 280 424 6.4e-49 PFAM
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000216011
AA Change: D502G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an arginyltransferase, an enzyme that is involved in posttranslational conjugation of arginine to N-terminal aspartate or glutamate residues. Conjugation of arginine to the N-terminal aspartate or glutamate targets proteins for ubiquitin-dependent degradation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous mutation of this gene results in developmental defects of the heart and embryonic lethality between E13.5 and E15.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A G 5: 107,543,945 E34G probably damaging Het
4932415D10Rik A T 10: 82,284,369 I4269N probably damaging Het
Aldh1a3 A T 7: 66,409,119 L157* probably null Het
Asic2 T A 11: 80,894,046 T356S probably benign Het
Cacna1g T A 11: 94,459,597 Q474L Het
Carf C A 1: 60,150,683 T689K possibly damaging Het
Carmil2 A G 8: 105,686,290 D6G probably benign Het
Ccnd2 A C 6: 127,150,700 V25G probably damaging Het
Ccnk T A 12: 108,193,719 F153L probably damaging Het
Cdh23 C T 10: 60,413,706 G808E probably damaging Het
Clec11a C T 7: 44,304,893 R212Q probably damaging Het
Cog4 T C 8: 110,881,752 W749R probably damaging Het
Col6a3 T A 1: 90,810,579 T1073S probably benign Het
Col6a4 T A 9: 106,075,010 D563V probably benign Het
Coq5 A G 5: 115,295,780 probably null Het
Crebbp A C 16: 4,096,482 H1292Q probably damaging Het
Csmd3 C A 15: 47,585,655 G2737W Het
Ddrgk1 T C 2: 130,658,307 Y223C probably damaging Het
Dennd1c T C 17: 57,066,796 Q589R probably benign Het
Dnah10 A G 5: 124,830,411 D4336G probably damaging Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
E330034G19Rik A T 14: 24,296,870 Q140L possibly damaging Het
Ergic3 A G 2: 156,008,860 Y83C probably damaging Het
Fam171a2 A T 11: 102,438,671 S421T probably benign Het
Fam26f T C 10: 34,126,367 E240G probably damaging Het
Fndc3a T A 14: 72,683,722 H4L possibly damaging Het
Gid8 T A 2: 180,717,963 Y213* probably null Het
Gm9573 G A 17: 35,621,239 P685L unknown Het
Hephl1 G T 9: 15,089,079 H292Q probably damaging Het
Hexb T C 13: 97,177,906 Y443C probably damaging Het
Htr1f C T 16: 64,926,425 R168H probably benign Het
Hus1 A G 11: 9,006,056 I159T probably damaging Het
Inha A G 1: 75,509,489 T143A probably benign Het
Itga8 A G 2: 12,189,519 I690T probably benign Het
Itgae G T 11: 73,125,263 C766F possibly damaging Het
Kank4 T C 4: 98,778,326 E628G probably benign Het
Kctd19 T C 8: 105,393,939 H221R probably benign Het
Llgl1 A G 11: 60,707,108 E351G probably benign Het
Lrba A G 3: 86,295,201 Y253C probably damaging Het
Lrp2 T A 2: 69,461,369 R3489* probably null Het
Lrriq1 T C 10: 103,214,779 N704S probably benign Het
Mbtps1 T C 8: 119,508,954 N995S probably benign Het
Mga T C 2: 119,926,532 C1077R probably damaging Het
Ndufv1 A T 19: 4,009,912 C142S probably damaging Het
Nkx3-1 T C 14: 69,192,211 L226P probably damaging Het
Nsd1 C T 13: 55,213,440 R74W probably damaging Het
Olfr136 A T 17: 38,335,333 M59L probably damaging Het
Olfr1451 G A 19: 12,999,064 C26Y probably benign Het
Olfr361 A C 2: 37,085,004 M248R probably benign Het
Olfr412 A G 11: 74,364,965 T99A probably benign Het
Olfr855 A T 9: 19,585,083 D182V probably benign Het
Phc3 A G 3: 30,914,542 V812A probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Ppp4c A T 7: 126,787,247 C193S possibly damaging Het
Rbbp5 C A 1: 132,494,285 P308T probably damaging Het
Rhot1 A G 11: 80,257,554 T607A probably null Het
Secisbp2l G A 2: 125,775,703 P18L probably damaging Het
Slc27a4 G A 2: 29,811,282 G362S probably damaging Het
Slc4a8 T C 15: 100,774,690 Y36H probably damaging Het
Sox17 T C 1: 4,492,224 Y251C probably damaging Het
Taf4b T C 18: 14,813,239 V373A probably benign Het
Tecpr2 T A 12: 110,914,750 V107E probably damaging Het
Them7 A G 2: 105,378,779 Y148C probably damaging Het
Tktl2 T A 8: 66,513,206 M472K possibly damaging Het
Ttn C T 2: 76,795,593 V15041I probably damaging Het
Ubr1 A G 2: 120,924,134 V751A possibly damaging Het
Vmn1r213 A T 13: 23,012,173 R309* probably null Het
Vmn2r10 A T 5: 108,996,346 D579E probably benign Het
Vmn2r118 T C 17: 55,610,207 Q435R probably null Het
Vmn2r50 A T 7: 10,047,644 H391Q probably damaging Het
Zbtb44 A T 9: 31,054,013 I240F probably benign Het
Other mutations in Ate1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02978:Ate1 APN 7 130394740 splice site probably benign
R0025:Ate1 UTSW 7 130503793 missense probably damaging 1.00
R0615:Ate1 UTSW 7 130513833 splice site probably benign
R1293:Ate1 UTSW 7 130394725 missense probably benign 0.03
R1299:Ate1 UTSW 7 130504755 missense probably damaging 0.99
R1476:Ate1 UTSW 7 130418571 splice site probably null
R1555:Ate1 UTSW 7 130509091 missense probably benign
R2061:Ate1 UTSW 7 130510913 missense probably damaging 1.00
R2358:Ate1 UTSW 7 130516165 missense probably damaging 0.99
R3840:Ate1 UTSW 7 130516137 missense probably damaging 1.00
R3950:Ate1 UTSW 7 130467292 missense probably damaging 1.00
R4038:Ate1 UTSW 7 130504765 missense probably damaging 1.00
R4716:Ate1 UTSW 7 130513781 missense probably damaging 1.00
R4954:Ate1 UTSW 7 130509018 missense probably benign 0.34
R5151:Ate1 UTSW 7 130507664 missense possibly damaging 0.77
R5796:Ate1 UTSW 7 130467268 missense probably damaging 1.00
R6297:Ate1 UTSW 7 130503840 missense probably damaging 1.00
R7146:Ate1 UTSW 7 130481778 splice site probably null
R7250:Ate1 UTSW 7 130519971 unclassified probably benign
R7291:Ate1 UTSW 7 130519931 missense probably benign
R7547:Ate1 UTSW 7 130504809 missense probably benign 0.19
R7781:Ate1 UTSW 7 130519427 missense probably damaging 0.99
R8006:Ate1 UTSW 7 130467388 missense probably damaging 1.00
R8257:Ate1 UTSW 7 130467307 missense probably damaging 1.00
R8342:Ate1 UTSW 7 130503765 missense probably benign 0.10
R8899:Ate1 UTSW 7 130394659 missense possibly damaging 0.95
R9146:Ate1 UTSW 7 130467292 missense probably damaging 1.00
X0011:Ate1 UTSW 7 130394661 missense probably damaging 1.00
Z1176:Ate1 UTSW 7 130504714 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTGAACAGCAGCATCCTCTC -3'
(R):5'- GTGACTCACTCCTTGTCTGCAG -3'

Sequencing Primer
(F):5'- CCGAGCACTTCTGTCCTACGAG -3'
(R):5'- CTCCCAGGAGAGTGGAATTAGCATC -3'
Posted On 2022-01-20