Incidental Mutation 'R9155:Olfr855'
ID 695312
Institutional Source Beutler Lab
Gene Symbol Olfr855
Ensembl Gene ENSMUSG00000043087
Gene Name olfactory receptor 855
Synonyms MOR148-1, GA_x6K02T2PVTD-13330461-13331399
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock # R9155 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 19582617-19586030 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 19585083 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 182 (D182V)
Ref Sequence ENSEMBL: ENSMUSP00000150218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061693] [ENSMUST00000215587]
AlphaFold Q7TRF8
Predicted Effect probably benign
Transcript: ENSMUST00000061693
AA Change: D182V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000054790
Gene: ENSMUSG00000043087
AA Change: D182V

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 1.7e-54 PFAM
Pfam:7TM_GPCR_Srsx 37 182 5.2e-8 PFAM
Pfam:7tm_1 43 292 2.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215587
AA Change: D182V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A G 5: 107,543,945 E34G probably damaging Het
4932415D10Rik A T 10: 82,284,369 I4269N probably damaging Het
Aldh1a3 A T 7: 66,409,119 L157* probably null Het
Asic2 T A 11: 80,894,046 T356S probably benign Het
Ate1 T C 7: 130,394,733 D459G probably damaging Het
Cacna1g T A 11: 94,459,597 Q474L Het
Carf C A 1: 60,150,683 T689K possibly damaging Het
Carmil2 A G 8: 105,686,290 D6G probably benign Het
Ccnd2 A C 6: 127,150,700 V25G probably damaging Het
Ccnk T A 12: 108,193,719 F153L probably damaging Het
Cdh23 C T 10: 60,413,706 G808E probably damaging Het
Clec11a C T 7: 44,304,893 R212Q probably damaging Het
Cog4 T C 8: 110,881,752 W749R probably damaging Het
Col6a3 T A 1: 90,810,579 T1073S probably benign Het
Col6a4 T A 9: 106,075,010 D563V probably benign Het
Coq5 A G 5: 115,295,780 probably null Het
Crebbp A C 16: 4,096,482 H1292Q probably damaging Het
Csmd3 C A 15: 47,585,655 G2737W Het
Ddrgk1 T C 2: 130,658,307 Y223C probably damaging Het
Dennd1c T C 17: 57,066,796 Q589R probably benign Het
Dnah10 A G 5: 124,830,411 D4336G probably damaging Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
E330034G19Rik A T 14: 24,296,870 Q140L possibly damaging Het
Ergic3 A G 2: 156,008,860 Y83C probably damaging Het
Fam171a2 A T 11: 102,438,671 S421T probably benign Het
Fam26f T C 10: 34,126,367 E240G probably damaging Het
Fndc3a T A 14: 72,683,722 H4L possibly damaging Het
Gid8 T A 2: 180,717,963 Y213* probably null Het
Gm9573 G A 17: 35,621,239 P685L unknown Het
Hephl1 G T 9: 15,089,079 H292Q probably damaging Het
Hexb T C 13: 97,177,906 Y443C probably damaging Het
Htr1f C T 16: 64,926,425 R168H probably benign Het
Hus1 A G 11: 9,006,056 I159T probably damaging Het
Inha A G 1: 75,509,489 T143A probably benign Het
Itga8 A G 2: 12,189,519 I690T probably benign Het
Itgae G T 11: 73,125,263 C766F possibly damaging Het
Kank4 T C 4: 98,778,326 E628G probably benign Het
Kctd19 T C 8: 105,393,939 H221R probably benign Het
Llgl1 A G 11: 60,707,108 E351G probably benign Het
Lrba A G 3: 86,295,201 Y253C probably damaging Het
Lrp2 T A 2: 69,461,369 R3489* probably null Het
Lrriq1 T C 10: 103,214,779 N704S probably benign Het
Mbtps1 T C 8: 119,508,954 N995S probably benign Het
Mga T C 2: 119,926,532 C1077R probably damaging Het
Ndufv1 A T 19: 4,009,912 C142S probably damaging Het
Nkx3-1 T C 14: 69,192,211 L226P probably damaging Het
Nsd1 C T 13: 55,213,440 R74W probably damaging Het
Olfr136 A T 17: 38,335,333 M59L probably damaging Het
Olfr1451 G A 19: 12,999,064 C26Y probably benign Het
Olfr361 A C 2: 37,085,004 M248R probably benign Het
Olfr412 A G 11: 74,364,965 T99A probably benign Het
Phc3 A G 3: 30,914,542 V812A probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Ppp4c A T 7: 126,787,247 C193S possibly damaging Het
Rbbp5 C A 1: 132,494,285 P308T probably damaging Het
Rhot1 A G 11: 80,257,554 T607A probably null Het
Secisbp2l G A 2: 125,775,703 P18L probably damaging Het
Slc27a4 G A 2: 29,811,282 G362S probably damaging Het
Slc4a8 T C 15: 100,774,690 Y36H probably damaging Het
Sox17 T C 1: 4,492,224 Y251C probably damaging Het
Taf4b T C 18: 14,813,239 V373A probably benign Het
Tecpr2 T A 12: 110,914,750 V107E probably damaging Het
Them7 A G 2: 105,378,779 Y148C probably damaging Het
Tktl2 T A 8: 66,513,206 M472K possibly damaging Het
Ttn C T 2: 76,795,593 V15041I probably damaging Het
Ubr1 A G 2: 120,924,134 V751A possibly damaging Het
Vmn1r213 A T 13: 23,012,173 R309* probably null Het
Vmn2r10 A T 5: 108,996,346 D579E probably benign Het
Vmn2r118 T C 17: 55,610,207 Q435R probably null Het
Vmn2r50 A T 7: 10,047,644 H391Q probably damaging Het
Zbtb44 A T 9: 31,054,013 I240F probably benign Het
Other mutations in Olfr855
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Olfr855 APN 9 19585320 missense possibly damaging 0.74
IGL01405:Olfr855 APN 9 19585205 missense probably benign 0.23
IGL01775:Olfr855 APN 9 19584705 missense probably benign 0.04
IGL01920:Olfr855 APN 9 19585022 missense probably benign 0.01
R0501:Olfr855 UTSW 9 19584618 missense probably damaging 1.00
R0600:Olfr855 UTSW 9 19585304 missense possibly damaging 0.47
R0667:Olfr855 UTSW 9 19585447 missense probably benign
R1769:Olfr855 UTSW 9 19585386 missense probably damaging 0.98
R3117:Olfr855 UTSW 9 19584941 missense probably damaging 0.99
R4002:Olfr855 UTSW 9 19584714 missense probably damaging 1.00
R4003:Olfr855 UTSW 9 19584714 missense probably damaging 1.00
R4043:Olfr855 UTSW 9 19584995 missense probably benign 0.16
R4243:Olfr855 UTSW 9 19584558 missense probably damaging 1.00
R4672:Olfr855 UTSW 9 19585430 missense possibly damaging 0.74
R4673:Olfr855 UTSW 9 19585430 missense possibly damaging 0.74
R4959:Olfr855 UTSW 9 19585208 missense probably benign
R4973:Olfr855 UTSW 9 19585208 missense probably benign
R5223:Olfr855 UTSW 9 19585026 missense probably benign 0.16
R5681:Olfr855 UTSW 9 19584899 missense probably damaging 1.00
R6005:Olfr855 UTSW 9 19584885 missense probably benign 0.45
R6017:Olfr855 UTSW 9 19585434 missense probably benign 0.00
R6145:Olfr855 UTSW 9 19584888 missense probably benign 0.02
R6615:Olfr855 UTSW 9 19584989 missense probably benign 0.05
R6771:Olfr855 UTSW 9 19585379 missense probably benign 0.16
R6969:Olfr855 UTSW 9 19584590 missense possibly damaging 0.77
R7239:Olfr855 UTSW 9 19585191 missense probably damaging 1.00
R7313:Olfr855 UTSW 9 19584642 missense probably damaging 1.00
R7361:Olfr855 UTSW 9 19584560 missense probably benign 0.00
R8112:Olfr855 UTSW 9 19584724 missense probably benign 0.44
R8470:Olfr855 UTSW 9 19584969 missense probably damaging 0.99
R9187:Olfr855 UTSW 9 19584654 missense probably benign 0.03
R9422:Olfr855 UTSW 9 19584672 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCCTTACAGTGATGGCCTATG -3'
(R):5'- TGACAAGTGAGTCCCGCAAG -3'

Sequencing Primer
(F):5'- ACAGTGATGGCCTATGATCGC -3'
(R):5'- TCCCGCAAGTAGAGAAGGCTTTATAC -3'
Posted On 2022-01-20