Mutagenetix > Incidental Mutation

Incidental Mutation 'R9155:Lrriq1'

695318

Institutional Source

Beutler Lab

Gene Symbol

Lrriq1

Ensembl Gene

ENSMUSG00000019892

Gene Name

leucine-rich repeats and IQ motif containing 1

Synonyms

LOC380658, 4930503E15Rik, Gm1557

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R9155 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

103046031-103236322 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 103214779 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 704 (N704S)

Ref Sequence

ENSEMBL: ENSMUSP00000020043 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020043] [ENSMUST00000123364] [ENSMUST00000166240]

AlphaFold

Q0P5X1

Predicted Effect

probably benign
Transcript: ENSMUST00000020043
AA Change: N704S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000020043
Gene: ENSMUSG00000019892
AA Change: N704S

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
Blast:IQ	290	312	1e-6	BLAST
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000123364

SMART Domains

Protein: ENSMUSP00000119783
Gene: ENSMUSG00000019892

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
Blast:IQ	290	312	6e-6	BLAST
coiled coil region	314	390	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166240
AA Change: N704S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: N704S

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
IQ	290	312	9.78e1	SMART
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC
LRR	873	894	2.14e1	SMART
LRR	895	917	4.45e1	SMART
LRR	984	1005	2.03e2	SMART
LRR	1029	1052	3.65e0	SMART
low complexity region	1244	1258	N/A	INTRINSIC
IQ	1279	1301	5.61e1	SMART
IQ	1339	1361	6.7e-3	SMART
low complexity region	1369	1394	N/A	INTRINSIC
low complexity region	1502	1518	N/A	INTRINSIC
low complexity region	1528	1543	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028K03Rik	A	G	5: 107,543,945	E34G	probably damaging	Het
4932415D10Rik	A	T	10: 82,284,369	I4269N	probably damaging	Het
Aldh1a3	A	T	7: 66,409,119	L157*	probably null	Het
Asic2	T	A	11: 80,894,046	T356S	probably benign	Het
Ate1	T	C	7: 130,394,733	D459G	probably damaging	Het
Cacna1g	T	A	11: 94,459,597	Q474L		Het
Carf	C	A	1: 60,150,683	T689K	possibly damaging	Het
Carmil2	A	G	8: 105,686,290	D6G	probably benign	Het
Ccnd2	A	C	6: 127,150,700	V25G	probably damaging	Het
Ccnk	T	A	12: 108,193,719	F153L	probably damaging	Het
Cdh23	C	T	10: 60,413,706	G808E	probably damaging	Het
Clec11a	C	T	7: 44,304,893	R212Q	probably damaging	Het
Cog4	T	C	8: 110,881,752	W749R	probably damaging	Het
Col6a3	T	A	1: 90,810,579	T1073S	probably benign	Het
Col6a4	T	A	9: 106,075,010	D563V	probably benign	Het
Coq5	A	G	5: 115,295,780		probably null	Het
Crebbp	A	C	16: 4,096,482	H1292Q	probably damaging	Het
Csmd3	C	A	15: 47,585,655	G2737W		Het
Ddrgk1	T	C	2: 130,658,307	Y223C	probably damaging	Het
Dennd1c	T	C	17: 57,066,796	Q589R	probably benign	Het
Dnah10	A	G	5: 124,830,411	D4336G	probably damaging	Het
Dnah11	C	T	12: 118,027,516	E2372K	probably damaging	Het
E330034G19Rik	A	T	14: 24,296,870	Q140L	possibly damaging	Het
Ergic3	A	G	2: 156,008,860	Y83C	probably damaging	Het
Fam171a2	A	T	11: 102,438,671	S421T	probably benign	Het
Fam26f	T	C	10: 34,126,367	E240G	probably damaging	Het
Fndc3a	T	A	14: 72,683,722	H4L	possibly damaging	Het
Gid8	T	A	2: 180,717,963	Y213*	probably null	Het
Gm9573	G	A	17: 35,621,239	P685L	unknown	Het
Hephl1	G	T	9: 15,089,079	H292Q	probably damaging	Het
Hexb	T	C	13: 97,177,906	Y443C	probably damaging	Het
Htr1f	C	T	16: 64,926,425	R168H	probably benign	Het
Hus1	A	G	11: 9,006,056	I159T	probably damaging	Het
Inha	A	G	1: 75,509,489	T143A	probably benign	Het
Itga8	A	G	2: 12,189,519	I690T	probably benign	Het
Itgae	G	T	11: 73,125,263	C766F	possibly damaging	Het
Kank4	T	C	4: 98,778,326	E628G	probably benign	Het
Kctd19	T	C	8: 105,393,939	H221R	probably benign	Het
Llgl1	A	G	11: 60,707,108	E351G	probably benign	Het
Lrba	A	G	3: 86,295,201	Y253C	probably damaging	Het
Lrp2	T	A	2: 69,461,369	R3489*	probably null	Het
Mbtps1	T	C	8: 119,508,954	N995S	probably benign	Het
Mga	T	C	2: 119,926,532	C1077R	probably damaging	Het
Ndufv1	A	T	19: 4,009,912	C142S	probably damaging	Het
Nkx3-1	T	C	14: 69,192,211	L226P	probably damaging	Het
Nsd1	C	T	13: 55,213,440	R74W	probably damaging	Het
Olfr136	A	T	17: 38,335,333	M59L	probably damaging	Het
Olfr1451	G	A	19: 12,999,064	C26Y	probably benign	Het
Olfr361	A	C	2: 37,085,004	M248R	probably benign	Het
Olfr412	A	G	11: 74,364,965	T99A	probably benign	Het
Olfr855	A	T	9: 19,585,083	D182V	probably benign	Het
Phc3	A	G	3: 30,914,542	V812A	probably benign	Het
Pigt	CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT	CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT	2: 164,499,669		probably null	Het
Ppp4c	A	T	7: 126,787,247	C193S	possibly damaging	Het
Rbbp5	C	A	1: 132,494,285	P308T	probably damaging	Het
Rhot1	A	G	11: 80,257,554	T607A	probably null	Het
Secisbp2l	G	A	2: 125,775,703	P18L	probably damaging	Het
Slc27a4	G	A	2: 29,811,282	G362S	probably damaging	Het
Slc4a8	T	C	15: 100,774,690	Y36H	probably damaging	Het
Sox17	T	C	1: 4,492,224	Y251C	probably damaging	Het
Taf4b	T	C	18: 14,813,239	V373A	probably benign	Het
Tecpr2	T	A	12: 110,914,750	V107E	probably damaging	Het
Them7	A	G	2: 105,378,779	Y148C	probably damaging	Het
Tktl2	T	A	8: 66,513,206	M472K	possibly damaging	Het
Ttn	C	T	2: 76,795,593	V15041I	probably damaging	Het
Ubr1	A	G	2: 120,924,134	V751A	possibly damaging	Het
Vmn1r213	A	T	13: 23,012,173	R309*	probably null	Het
Vmn2r10	A	T	5: 108,996,346	D579E	probably benign	Het
Vmn2r118	T	C	17: 55,610,207	Q435R	probably null	Het
Vmn2r50	A	T	7: 10,047,644	H391Q	probably damaging	Het
Zbtb44	A	T	9: 31,054,013	I240F	probably benign	Het

Other mutations in Lrriq1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00988:Lrriq1	APN	10	103161896	missense	probably damaging	0.99
IGL01523:Lrriq1	APN	10	103218116	nonsense	probably null
IGL01637:Lrriq1	APN	10	103215628	missense	probably benign
IGL02019:Lrriq1	APN	10	103178800	missense	probably benign	0.02
IGL02153:Lrriq1	APN	10	103170479	missense	probably benign	0.01
IGL02341:Lrriq1	APN	10	103224941	missense	probably benign	0.03
IGL02343:Lrriq1	APN	10	103234163	splice site	probably benign
IGL02408:Lrriq1	APN	10	103146281	missense	probably benign	0.17
IGL02431:Lrriq1	APN	10	103200639	missense	probably damaging	1.00
IGL02540:Lrriq1	APN	10	103215019	missense	probably benign	0.02
IGL02558:Lrriq1	APN	10	103146283	missense	probably damaging	1.00
IGL02613:Lrriq1	APN	10	103144548	missense	probably damaging	0.99
IGL02642:Lrriq1	APN	10	103221461	critical splice acceptor site	probably null
IGL03027:Lrriq1	APN	10	103227196	missense	probably benign	0.35
PIT4362001:Lrriq1	UTSW	10	103071194	missense	probably benign	0.26
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0124:Lrriq1	UTSW	10	103170420	critical splice donor site	probably null
R0244:Lrriq1	UTSW	10	103215773	missense	probably damaging	0.98
R0323:Lrriq1	UTSW	10	103221289	missense	possibly damaging	0.91
R0515:Lrriq1	UTSW	10	103068968	splice site	probably null
R0522:Lrriq1	UTSW	10	103161777	missense	probably damaging	0.99
R0701:Lrriq1	UTSW	10	103234044	missense	probably benign
R1220:Lrriq1	UTSW	10	103071129	missense	probably benign	0.05
R1261:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1262:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1451:Lrriq1	UTSW	10	103202515	splice site	probably benign
R1642:Lrriq1	UTSW	10	103214456	missense	probably benign	0.13
R1643:Lrriq1	UTSW	10	103214824	missense	probably benign	0.00
R1647:Lrriq1	UTSW	10	103170648	nonsense	probably null
R1830:Lrriq1	UTSW	10	103161759	missense	probably benign
R1843:Lrriq1	UTSW	10	103227173	splice site	probably null
R2128:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2129:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2199:Lrriq1	UTSW	10	103068913	missense	probably damaging	1.00
R2354:Lrriq1	UTSW	10	103189987	missense	probably damaging	1.00
R2495:Lrriq1	UTSW	10	103202381	missense	probably damaging	0.97
R2897:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2898:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2922:Lrriq1	UTSW	10	103214675	missense	probably benign	0.00
R2939:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R2965:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R2966:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R3081:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R3115:Lrriq1	UTSW	10	103170433	missense	probably benign	0.00
R3745:Lrriq1	UTSW	10	103170856	missense	probably damaging	0.99
R3813:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3814:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3885:Lrriq1	UTSW	10	103216106	missense	probably damaging	0.96
R4378:Lrriq1	UTSW	10	103202364	missense	probably damaging	1.00
R4632:Lrriq1	UTSW	10	103221427	missense	probably damaging	1.00
R4633:Lrriq1	UTSW	10	103200563	nonsense	probably null
R4663:Lrriq1	UTSW	10	103063412	missense	possibly damaging	0.88
R4702:Lrriq1	UTSW	10	103215749	missense	possibly damaging	0.65
R4793:Lrriq1	UTSW	10	103170466	missense	probably benign	0.25
R4801:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4802:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4815:Lrriq1	UTSW	10	103144878	missense	probably benign	0.10
R4872:Lrriq1	UTSW	10	103178788	missense	possibly damaging	0.56
R4877:Lrriq1	UTSW	10	103234038	missense	possibly damaging	0.88
R4894:Lrriq1	UTSW	10	103161752	missense	possibly damaging	0.86
R4990:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R4991:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R5011:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5013:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5122:Lrriq1	UTSW	10	103187453	missense	probably damaging	1.00
R5282:Lrriq1	UTSW	10	103215345	missense	probably benign	0.01
R5311:Lrriq1	UTSW	10	103214587	missense	probably damaging	1.00
R5567:Lrriq1	UTSW	10	103170596	missense	possibly damaging	0.56
R5643:Lrriq1	UTSW	10	103215440	missense	probably benign	0.00
R5683:Lrriq1	UTSW	10	103173375	missense	probably damaging	1.00
R5916:Lrriq1	UTSW	10	103221382	nonsense	probably null
R6008:Lrriq1	UTSW	10	103170464	missense	probably damaging	1.00
R6022:Lrriq1	UTSW	10	103215534	missense	possibly damaging	0.90
R6224:Lrriq1	UTSW	10	103215757	missense	probably damaging	1.00
R6254:Lrriq1	UTSW	10	103215451	missense	probably benign	0.15
R6311:Lrriq1	UTSW	10	103173393	missense	probably benign	0.03
R6460:Lrriq1	UTSW	10	103200698	missense	probably damaging	1.00
R6502:Lrriq1	UTSW	10	103227184	missense	probably damaging	0.99
R6637:Lrriq1	UTSW	10	103221432	missense	probably benign	0.06
R6719:Lrriq1	UTSW	10	103071116	missense	probably damaging	1.00
R6736:Lrriq1	UTSW	10	103181889	critical splice acceptor site	probably null
R6928:Lrriq1	UTSW	10	103214939	missense	possibly damaging	0.95
R6991:Lrriq1	UTSW	10	103187458	missense	probably damaging	1.00
R7174:Lrriq1	UTSW	10	103224965	missense	probably benign
R7241:Lrriq1	UTSW	10	103215973	missense	probably damaging	1.00
R7248:Lrriq1	UTSW	10	103223750	missense	possibly damaging	0.85
R7287:Lrriq1	UTSW	10	103216016	missense	probably benign	0.00
R7402:Lrriq1	UTSW	10	103221324	missense	possibly damaging	0.87
R7439:Lrriq1	UTSW	10	103214519	missense	probably benign	0.21
R7585:Lrriq1	UTSW	10	103214946	missense	possibly damaging	0.93
R7611:Lrriq1	UTSW	10	103200571	missense	possibly damaging	0.54
R7634:Lrriq1	UTSW	10	103200601	missense	probably damaging	1.00
R7767:Lrriq1	UTSW	10	103215954	missense	probably damaging	0.99
R7809:Lrriq1	UTSW	10	103215817	missense	probably damaging	0.99
R7910:Lrriq1	UTSW	10	103215194	nonsense	probably null
R8131:Lrriq1	UTSW	10	103215711	missense	possibly damaging	0.57
R8156:Lrriq1	UTSW	10	103156335	critical splice donor site	probably null
R8211:Lrriq1	UTSW	10	103170547	missense	probably damaging	1.00
R8304:Lrriq1	UTSW	10	103234068	missense	possibly damaging	0.57
R8487:Lrriq1	UTSW	10	103215053	missense	probably damaging	0.98
R8500:Lrriq1	UTSW	10	103046155	missense
R9013:Lrriq1	UTSW	10	103215070	missense	probably damaging	1.00
R9099:Lrriq1	UTSW	10	103216003	missense	probably damaging	0.98
R9320:Lrriq1	UTSW	10	103221283	missense	probably benign
R9384:Lrriq1	UTSW	10	103170597	missense	probably benign	0.00
R9469:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R9585:Lrriq1	UTSW	10	103215389	missense	probably benign
R9706:Lrriq1	UTSW	10	103046041	missense
R9780:Lrriq1	UTSW	10	103189963	missense	probably damaging	1.00
X0026:Lrriq1	UTSW	10	103215704	nonsense	probably null
Z1088:Lrriq1	UTSW	10	103202446	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202359	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202360	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103234085	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTCAAAGATTTCAGCCCAGGG -3'
(R):5'- TCCTGAACCTGTAGAAAGAAGTG -3'

Sequencing Primer
(F):5'- GATTTCAGCCCAGGGTTTAAATG -3'
(R):5'- TGAACCTGTAGAAAGAAGTGTAACAC -3'

Posted On

2022-01-20