Incidental Mutation 'R9155:Taf4b'
ID 695344
Institutional Source Beutler Lab
Gene Symbol Taf4b
Ensembl Gene ENSMUSG00000054321
Gene Name TATA-box binding protein associated factor 4b
Synonyms Taf2c2, TAFII105, 2610524B04Rik, 105kDa, 4932409F03Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock # R9155 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 14783245-14900359 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 14813239 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 373 (V373A)
Ref Sequence ENSEMBL: ENSMUSP00000126909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169862]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000169862
AA Change: V373A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000126909
Gene: ENSMUSG00000054321
AA Change: V373A

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
Pfam:TAFH 257 348 5.3e-39 PFAM
low complexity region 359 376 N/A INTRINSIC
low complexity region 412 422 N/A INTRINSIC
Pfam:TAF4 610 852 4e-72 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TATA binding protein (TBP) and TBP-associated factors (TAFs) participate in the formation of the TFIID protein complex, which is involved in initiation of transcription of genes by RNA polymerase II. This gene encodes a cell type-specific TAF that may be responsible for mediating transcription by a subset of activators in B cells. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation are infertile due to a granulosa cell defect preventing normal follicle formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A G 5: 107,543,945 E34G probably damaging Het
4932415D10Rik A T 10: 82,284,369 I4269N probably damaging Het
Aldh1a3 A T 7: 66,409,119 L157* probably null Het
Asic2 T A 11: 80,894,046 T356S probably benign Het
Ate1 T C 7: 130,394,733 D459G probably damaging Het
Cacna1g T A 11: 94,459,597 Q474L Het
Carf C A 1: 60,150,683 T689K possibly damaging Het
Carmil2 A G 8: 105,686,290 D6G probably benign Het
Ccnd2 A C 6: 127,150,700 V25G probably damaging Het
Ccnk T A 12: 108,193,719 F153L probably damaging Het
Cdh23 C T 10: 60,413,706 G808E probably damaging Het
Clec11a C T 7: 44,304,893 R212Q probably damaging Het
Cog4 T C 8: 110,881,752 W749R probably damaging Het
Col6a3 T A 1: 90,810,579 T1073S probably benign Het
Col6a4 T A 9: 106,075,010 D563V probably benign Het
Coq5 A G 5: 115,295,780 probably null Het
Crebbp A C 16: 4,096,482 H1292Q probably damaging Het
Csmd3 C A 15: 47,585,655 G2737W Het
Ddrgk1 T C 2: 130,658,307 Y223C probably damaging Het
Dennd1c T C 17: 57,066,796 Q589R probably benign Het
Dnah10 A G 5: 124,830,411 D4336G probably damaging Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
E330034G19Rik A T 14: 24,296,870 Q140L possibly damaging Het
Ergic3 A G 2: 156,008,860 Y83C probably damaging Het
Fam171a2 A T 11: 102,438,671 S421T probably benign Het
Fam26f T C 10: 34,126,367 E240G probably damaging Het
Fndc3a T A 14: 72,683,722 H4L possibly damaging Het
Gid8 T A 2: 180,717,963 Y213* probably null Het
Gm9573 G A 17: 35,621,239 P685L unknown Het
Hephl1 G T 9: 15,089,079 H292Q probably damaging Het
Hexb T C 13: 97,177,906 Y443C probably damaging Het
Htr1f C T 16: 64,926,425 R168H probably benign Het
Hus1 A G 11: 9,006,056 I159T probably damaging Het
Inha A G 1: 75,509,489 T143A probably benign Het
Itga8 A G 2: 12,189,519 I690T probably benign Het
Itgae G T 11: 73,125,263 C766F possibly damaging Het
Kank4 T C 4: 98,778,326 E628G probably benign Het
Kctd19 T C 8: 105,393,939 H221R probably benign Het
Llgl1 A G 11: 60,707,108 E351G probably benign Het
Lrba A G 3: 86,295,201 Y253C probably damaging Het
Lrp2 T A 2: 69,461,369 R3489* probably null Het
Lrriq1 T C 10: 103,214,779 N704S probably benign Het
Mbtps1 T C 8: 119,508,954 N995S probably benign Het
Mga T C 2: 119,926,532 C1077R probably damaging Het
Ndufv1 A T 19: 4,009,912 C142S probably damaging Het
Nkx3-1 T C 14: 69,192,211 L226P probably damaging Het
Nsd1 C T 13: 55,213,440 R74W probably damaging Het
Olfr136 A T 17: 38,335,333 M59L probably damaging Het
Olfr1451 G A 19: 12,999,064 C26Y probably benign Het
Olfr361 A C 2: 37,085,004 M248R probably benign Het
Olfr412 A G 11: 74,364,965 T99A probably benign Het
Olfr855 A T 9: 19,585,083 D182V probably benign Het
Phc3 A G 3: 30,914,542 V812A probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Ppp4c A T 7: 126,787,247 C193S possibly damaging Het
Rbbp5 C A 1: 132,494,285 P308T probably damaging Het
Rhot1 A G 11: 80,257,554 T607A probably null Het
Secisbp2l G A 2: 125,775,703 P18L probably damaging Het
Slc27a4 G A 2: 29,811,282 G362S probably damaging Het
Slc4a8 T C 15: 100,774,690 Y36H probably damaging Het
Sox17 T C 1: 4,492,224 Y251C probably damaging Het
Tecpr2 T A 12: 110,914,750 V107E probably damaging Het
Them7 A G 2: 105,378,779 Y148C probably damaging Het
Tktl2 T A 8: 66,513,206 M472K possibly damaging Het
Ttn C T 2: 76,795,593 V15041I probably damaging Het
Ubr1 A G 2: 120,924,134 V751A possibly damaging Het
Vmn1r213 A T 13: 23,012,173 R309* probably null Het
Vmn2r10 A T 5: 108,996,346 D579E probably benign Het
Vmn2r118 T C 17: 55,610,207 Q435R probably null Het
Vmn2r50 A T 7: 10,047,644 H391Q probably damaging Het
Zbtb44 A T 9: 31,054,013 I240F probably benign Het
Other mutations in Taf4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01658:Taf4b APN 18 14844420 missense probably damaging 1.00
IGL01755:Taf4b APN 18 14897985 missense probably benign
IGL01755:Taf4b APN 18 14897986 missense probably benign 0.13
IGL02049:Taf4b APN 18 14830139 missense probably benign 0.00
IGL02650:Taf4b APN 18 14841983 nonsense probably null
IGL03078:Taf4b APN 18 14813554 missense possibly damaging 0.48
IGL03169:Taf4b APN 18 14821535 missense probably damaging 1.00
IGL03261:Taf4b APN 18 14821528 missense probably benign
adirondack UTSW 18 14804578 missense probably null 0.16
R0266:Taf4b UTSW 18 14813077 splice site probably benign
R0385:Taf4b UTSW 18 14783760 missense probably benign 0.00
R1015:Taf4b UTSW 18 14813098 missense probably damaging 1.00
R1054:Taf4b UTSW 18 14821473 missense probably benign 0.00
R1416:Taf4b UTSW 18 14821427 splice site probably benign
R1435:Taf4b UTSW 18 14807409 missense probably damaging 1.00
R1609:Taf4b UTSW 18 14835881 missense probably damaging 1.00
R1611:Taf4b UTSW 18 14844469 missense probably null 1.00
R1906:Taf4b UTSW 18 14822102 missense probably benign 0.00
R2038:Taf4b UTSW 18 14807399 missense probably damaging 1.00
R2890:Taf4b UTSW 18 14804792 missense probably damaging 1.00
R4527:Taf4b UTSW 18 14821442 missense probably damaging 1.00
R4559:Taf4b UTSW 18 14813526 missense probably damaging 1.00
R4773:Taf4b UTSW 18 14804520 missense probably benign 0.30
R4857:Taf4b UTSW 18 14804578 missense probably null 0.16
R4946:Taf4b UTSW 18 14813542 missense probably damaging 1.00
R4984:Taf4b UTSW 18 14835816 missense probably damaging 1.00
R4994:Taf4b UTSW 18 14898043 missense probably damaging 0.99
R5010:Taf4b UTSW 18 14822172 missense possibly damaging 0.59
R5155:Taf4b UTSW 18 14830095 missense probably benign 0.07
R5874:Taf4b UTSW 18 14804554 missense probably benign
R6079:Taf4b UTSW 18 14822198 missense possibly damaging 0.75
R6303:Taf4b UTSW 18 14807355 missense probably damaging 1.00
R6304:Taf4b UTSW 18 14807355 missense probably damaging 1.00
R6372:Taf4b UTSW 18 14804733 missense probably damaging 1.00
R6972:Taf4b UTSW 18 14813347 missense possibly damaging 0.86
R7538:Taf4b UTSW 18 14813545 missense probably damaging 1.00
R7790:Taf4b UTSW 18 14813274 missense probably damaging 1.00
R8021:Taf4b UTSW 18 14804524 missense probably damaging 1.00
R8072:Taf4b UTSW 18 14821528 missense probably benign
R8075:Taf4b UTSW 18 14783692 missense possibly damaging 0.58
R8145:Taf4b UTSW 18 14830028 missense probably damaging 1.00
R8221:Taf4b UTSW 18 14898049 missense probably damaging 1.00
R8320:Taf4b UTSW 18 14783692 missense possibly damaging 0.58
R8509:Taf4b UTSW 18 14898055 missense probably damaging 1.00
R8535:Taf4b UTSW 18 14822138 missense probably damaging 0.99
R8772:Taf4b UTSW 18 14835852 missense probably damaging 1.00
R8805:Taf4b UTSW 18 14813428 missense possibly damaging 0.65
R8874:Taf4b UTSW 18 14830070 missense probably benign 0.39
R9254:Taf4b UTSW 18 14813374 missense probably damaging 0.98
R9338:Taf4b UTSW 18 14821498 missense probably benign 0.00
R9379:Taf4b UTSW 18 14813374 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGCTTACCTAACTTGATGTGG -3'
(R):5'- ACACTGCTGCCACTGTATTTG -3'

Sequencing Primer
(F):5'- GCAAATTTCGCTTTACTTTGAGC -3'
(R):5'- CTGCCACTGTATTTGGTACTGATG -3'
Posted On 2022-01-20