Mutagenetix > Incidental Mutation

Incidental Mutation 'R9156:Ttll4'

695350

Institutional Source

Beutler Lab

Gene Symbol

Ttll4

Ensembl Gene

ENSMUSG00000033257

Gene Name

tubulin tyrosine ligase-like family, member 4

Synonyms

4632407P03Rik

MMRRC Submission

068974-MU

Accession Numbers

Genbank: NM_001014974.1; Ensembl: ENSMUST00000042125

Essential gene?

Possibly non essential (E-score: 0.368) question?

Stock #

R9156 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74661745-74703730 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 74680066 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 359 (F359L)

Ref Sequence

ENSEMBL: ENSMUSP00000037406 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678] [ENSMUST00000129890] [ENSMUST00000141119]

AlphaFold

Q80UG8

Predicted Effect

probably benign
Transcript: ENSMUST00000042125
AA Change: F359L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: F359L

Domain	Start	End	E-Value	Type
low complexity region	504	544	N/A	INTRINSIC
Pfam:TTL	645	940	2.2e-106	PFAM
low complexity region	942	961	N/A	INTRINSIC
low complexity region	1103	1113	N/A	INTRINSIC
low complexity region	1168	1182	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113678
AA Change: F359L

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: F359L

Domain	Start	End	E-Value	Type
low complexity region	504	544	N/A	INTRINSIC
Pfam:TTL	636	876	3.4e-82	PFAM
low complexity region	878	897	N/A	INTRINSIC
low complexity region	1039	1049	N/A	INTRINSIC
low complexity region	1104	1118	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129890

SMART Domains

Protein: ENSMUSP00000119964
Gene: ENSMUSG00000033257

Domain	Start	End	E-Value	Type
low complexity region	69	101	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141119

SMART Domains

Protein: ENSMUSP00000116733
Gene: ENSMUSG00000033257

Domain	Start	End	E-Value	Type
low complexity region	56	96	N/A	INTRINSIC

Meta Mutation Damage Score

0.0613

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

98% (61/62)

Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	G	6: 121,670,998	L1150V	probably damaging	Het
AB124611	A	G	9: 21,544,693	D194G	possibly damaging	Het
Adgrv1	A	G	13: 81,521,183	L2418P	probably benign	Het
Ap3m1	A	G	14: 21,040,084	S213P	probably damaging	Het
Apobec2	A	T	17: 48,432,503	L36H		Het
Arrb1	A	G	7: 99,588,073	D78G		Het
Astn1	A	G	1: 158,510,985	Q434R	probably damaging	Het
Cadps	C	G	14: 12,705,676	D240H	probably damaging	Het
Cmya5	A	C	13: 93,097,370	D403E	unknown	Het
Crxos	A	C	7: 15,897,511	I45L	probably benign	Het
Dmxl1	C	G	18: 49,939,572	N2744K	probably damaging	Het
Dnah2	A	G	11: 69,422,861	I4204T		Het
Ei24	A	G	9: 36,786,031	S134P	probably damaging	Het
Eif2ak3	G	T	6: 70,883,630	V397F	probably damaging	Het
Eif4g2	T	C	7: 111,073,762	I134V		Het
Fam186a	A	G	15: 99,943,278	I1695T	possibly damaging	Het
Gcnt3	T	C	9: 70,034,657	M210V	probably damaging	Het
Gm21671	CTTT	C	5: 25,950,859		probably benign	Het
Gm4788	A	G	1: 139,732,347	I680T	probably damaging	Het
Gpatch8	A	G	11: 102,479,473	S1080P	probably benign	Het
Gtf3c1	A	G	7: 125,645,777	L1695P	possibly damaging	Het
Haus3	A	G	5: 34,167,650	F222L	probably damaging	Het
Kbtbd8	C	T	6: 95,122,844	Q445*	probably null	Het
Kcnc3	A	G	7: 44,591,168	N95D	probably damaging	Het
Krt40	C	T	11: 99,539,867		probably null	Het
Lgi1	A	G	19: 38,301,298	T271A	probably benign	Het
Ltbp2	G	A	12: 84,791,090	P1192L	probably benign	Het
Map3k21	A	G	8: 125,938,724	T551A	possibly damaging	Het
Muc5ac	T	C	7: 141,809,792	I2280T	unknown	Het
Mug1	C	A	6: 121,874,431	D762E	probably damaging	Het
Myo1e	A	T	9: 70,359,323	N615I	probably damaging	Het
Olfr1280	T	C	2: 111,315,482	M1T	probably null	Het
Olfr564	T	C	7: 102,804,132	L218P	probably damaging	Het
Pld5	T	C	1: 175,975,538	E387G	possibly damaging	Het
Pld5	A	G	1: 176,074,437	V195A	probably benign	Het
Rad54l	T	C	4: 116,123,152		probably benign	Het
Rnf123	A	T	9: 108,063,028		probably benign	Het
Rnf213	A	G	11: 119,440,748	E2262G		Het
Rp1	C	A	1: 4,163,938	V910L	unknown	Het
Rpp21	A	T	17: 36,257,515	C23S	probably benign	Het
Scn11a	T	C	9: 119,759,923	M1306V	possibly damaging	Het
Scn2b	C	T	9: 45,125,436	L81F	possibly damaging	Het
Sco2	T	C	15: 89,372,160	D97G	probably damaging	Het
Slc25a54	T	C	3: 109,094,232	V112A	probably benign	Het
Slc5a11	A	T	7: 123,265,269	K363*	probably null	Het
Smg1	G	T	7: 118,154,661	T2563K	unknown	Het
Snap47	A	T	11: 59,428,464	S283T	probably damaging	Het
Stat1	G	T	1: 52,139,229	R274L	probably damaging	Het
Stoml1	A	G	9: 58,257,126	T166A		Het
Svs2	G	T	2: 164,237,589	Q133K	probably benign	Het
Tas2r107	T	A	6: 131,659,459	H209L	probably benign	Het
Tmco3	T	A	8: 13,310,228	V477D	possibly damaging	Het
Tmem131	A	T	1: 36,841,686	S168T	possibly damaging	Het
Tmem41a	T	C	16: 21,937,109	N149S	probably damaging	Het
Ttn	T	A	2: 76,954,818	M784L	unknown	Het
Ubr1	A	G	2: 120,873,122		probably null	Het
Ubxn2b	C	T	4: 6,214,646	P227S	probably damaging	Het
Upb1	C	T	10: 75,430,127	L263F	probably benign	Het
Usp15	T	A	10: 123,113,648	T935S	probably benign	Het
Zscan4-ps3	G	A	7: 11,613,237	C400Y	probably damaging	Het

Other mutations in Ttll4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01606:Ttll4	APN	1	74685893	missense	probably damaging	1.00
IGL01743:Ttll4	APN	1	74688193	missense	possibly damaging	0.63
IGL01914:Ttll4	APN	1	74679058	missense	probably benign	0.01
IGL02288:Ttll4	APN	1	74679401	missense	probably benign	0.05
IGL02621:Ttll4	APN	1	74687484	missense	probably damaging	1.00
IGL02662:Ttll4	APN	1	74687231	splice site	probably null
IGL02890:Ttll4	APN	1	74687339	nonsense	probably null
IGL02937:Ttll4	APN	1	74679503	missense	possibly damaging	0.92
IGL03178:Ttll4	APN	1	74680408	missense	probably damaging	0.96
IGL03412:Ttll4	APN	1	74687321	missense	probably benign	0.28
1mM(1):Ttll4	UTSW	1	74689980	missense	probably null	1.00
R0083:Ttll4	UTSW	1	74679769	missense	probably benign	0.13
R0108:Ttll4	UTSW	1	74679769	missense	probably benign	0.13
R0135:Ttll4	UTSW	1	74679928	missense	possibly damaging	0.86
R0137:Ttll4	UTSW	1	74679692	missense	possibly damaging	0.74
R0306:Ttll4	UTSW	1	74696757	missense	probably benign	0.28
R0506:Ttll4	UTSW	1	74688618	missense	probably benign	0.06
R0555:Ttll4	UTSW	1	74688280	missense	probably damaging	1.00
R1617:Ttll4	UTSW	1	74679401	missense	probably benign	0.05
R1649:Ttll4	UTSW	1	74697470	missense	possibly damaging	0.52
R1793:Ttll4	UTSW	1	74687840	missense	possibly damaging	0.91
R1898:Ttll4	UTSW	1	74697482	missense	probably benign	0.01
R1952:Ttll4	UTSW	1	74687559	missense	probably damaging	0.99
R1987:Ttll4	UTSW	1	74685368	missense	possibly damaging	0.81
R1989:Ttll4	UTSW	1	74685368	missense	possibly damaging	0.81
R2067:Ttll4	UTSW	1	74680382	missense	possibly damaging	0.94
R2162:Ttll4	UTSW	1	74686391	missense	probably damaging	1.00
R2185:Ttll4	UTSW	1	74679829	missense	possibly damaging	0.54
R2875:Ttll4	UTSW	1	74686438	splice site	probably null
R2876:Ttll4	UTSW	1	74686438	splice site	probably null
R2895:Ttll4	UTSW	1	74685358	missense	possibly damaging	0.92
R2896:Ttll4	UTSW	1	74685358	missense	possibly damaging	0.92
R3157:Ttll4	UTSW	1	74697611	missense	possibly damaging	0.81
R3832:Ttll4	UTSW	1	74686391	missense	probably damaging	1.00
R4707:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R4784:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R4785:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R5176:Ttll4	UTSW	1	74679286	missense	probably damaging	0.99
R5202:Ttll4	UTSW	1	74687852	critical splice donor site	probably null
R5244:Ttll4	UTSW	1	74696448	missense	probably benign	0.30
R5264:Ttll4	UTSW	1	74686376	missense	possibly damaging	0.92
R5452:Ttll4	UTSW	1	74679321	missense	probably benign	0.06
R5992:Ttll4	UTSW	1	74685391	missense	probably damaging	1.00
R6111:Ttll4	UTSW	1	74697539	missense	possibly damaging	0.95
R6722:Ttll4	UTSW	1	74681789	missense	possibly damaging	0.95
R6776:Ttll4	UTSW	1	74681353	missense	probably damaging	1.00
R6815:Ttll4	UTSW	1	74679349	missense	possibly damaging	0.89
R6836:Ttll4	UTSW	1	74689413	missense	probably damaging	0.98
R6963:Ttll4	UTSW	1	74681816	missense	probably damaging	1.00
R7271:Ttll4	UTSW	1	74688661	missense	possibly damaging	0.83
R7508:Ttll4	UTSW	1	74687259	missense	possibly damaging	0.81
R7714:Ttll4	UTSW	1	74679413	missense	probably benign	0.00
R7837:Ttll4	UTSW	1	74681757	critical splice acceptor site	probably null
R8032:Ttll4	UTSW	1	74696473	missense	possibly damaging	0.82
R8036:Ttll4	UTSW	1	74679230	missense	probably benign	0.02
R8115:Ttll4	UTSW	1	74687330	nonsense	probably null
R8949:Ttll4	UTSW	1	74681816	missense	probably damaging	0.99
R9145:Ttll4	UTSW	1	74679790	missense	probably benign	0.02
R9329:Ttll4	UTSW	1	74685962	missense	possibly damaging	0.85
R9701:Ttll4	UTSW	1	74681323	missense	probably benign	0.07
R9802:Ttll4	UTSW	1	74681323	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- GATGTCACTGCCCCTATCAC -3'
(R):5'- AGGAGGTGAATGCTGATCCTC -3'

Sequencing Primer
(F):5'- AGTGTTACCTCTTCCCAGTGCAG -3'
(R):5'- GCTGATCCTCTTGGTACAGAAGAC -3'

Posted On

2022-01-20