Incidental Mutation 'R9156:Ttll4'
ID 695350
Institutional Source Beutler Lab
Gene Symbol Ttll4
Ensembl Gene ENSMUSG00000033257
Gene Name tubulin tyrosine ligase-like family, member 4
Synonyms 4632407P03Rik
Accession Numbers

Genbank: NM_001014974.1; Ensembl: ENSMUST00000042125

Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock # R9156 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 74661745-74703730 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 74680066 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 359 (F359L)
Ref Sequence ENSEMBL: ENSMUSP00000037406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678] [ENSMUST00000129890] [ENSMUST00000141119]
AlphaFold Q80UG8
Predicted Effect probably benign
Transcript: ENSMUST00000042125
AA Change: F359L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: F359L

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 645 940 2.2e-106 PFAM
low complexity region 942 961 N/A INTRINSIC
low complexity region 1103 1113 N/A INTRINSIC
low complexity region 1168 1182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113678
AA Change: F359L

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: F359L

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 636 876 3.4e-82 PFAM
low complexity region 878 897 N/A INTRINSIC
low complexity region 1039 1049 N/A INTRINSIC
low complexity region 1104 1118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129890
SMART Domains Protein: ENSMUSP00000119964
Gene: ENSMUSG00000033257

DomainStartEndE-ValueType
low complexity region 69 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141119
SMART Domains Protein: ENSMUSP00000116733
Gene: ENSMUSG00000033257

DomainStartEndE-ValueType
low complexity region 56 96 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,670,998 L1150V probably damaging Het
AB124611 A G 9: 21,544,693 D194G possibly damaging Het
Adgrv1 A G 13: 81,521,183 L2418P probably benign Het
Ap3m1 A G 14: 21,040,084 S213P probably damaging Het
Apobec2 A T 17: 48,432,503 L36H Het
Arrb1 A G 7: 99,588,073 D78G Het
Astn1 A G 1: 158,510,985 Q434R probably damaging Het
Cadps C G 14: 12,705,676 D240H probably damaging Het
Cmya5 A C 13: 93,097,370 D403E unknown Het
Crxos A C 7: 15,897,511 I45L probably benign Het
Dmxl1 C G 18: 49,939,572 N2744K probably damaging Het
Dnah2 A G 11: 69,422,861 I4204T Het
Ei24 A G 9: 36,786,031 S134P probably damaging Het
Eif2ak3 G T 6: 70,883,630 V397F probably damaging Het
Eif4g2 T C 7: 111,073,762 I134V Het
Fam186a A G 15: 99,943,278 I1695T possibly damaging Het
Gcnt3 T C 9: 70,034,657 M210V probably damaging Het
Gm21671 CTTT C 5: 25,950,859 probably benign Het
Gm4788 A G 1: 139,732,347 I680T probably damaging Het
Gpatch8 A G 11: 102,479,473 S1080P probably benign Het
Gtf3c1 A G 7: 125,645,777 L1695P possibly damaging Het
Haus3 A G 5: 34,167,650 F222L probably damaging Het
Kbtbd8 C T 6: 95,122,844 Q445* probably null Het
Kcnc3 A G 7: 44,591,168 N95D probably damaging Het
Krt40 C T 11: 99,539,867 probably null Het
Lgi1 A G 19: 38,301,298 T271A probably benign Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Map3k21 A G 8: 125,938,724 T551A possibly damaging Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Mug1 C A 6: 121,874,431 D762E probably damaging Het
Myo1e A T 9: 70,359,323 N615I probably damaging Het
Olfr1280 T C 2: 111,315,482 M1T probably null Het
Olfr564 T C 7: 102,804,132 L218P probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pld5 T C 1: 175,975,538 E387G possibly damaging Het
Pld5 A G 1: 176,074,437 V195A probably benign Het
Rad54l T C 4: 116,123,152 probably benign Het
Rnf213 A G 11: 119,440,748 E2262G Het
Rp1 C A 1: 4,163,938 V910L unknown Het
Scn11a T C 9: 119,759,923 M1306V possibly damaging Het
Scn2b C T 9: 45,125,436 L81F possibly damaging Het
Sco2 T C 15: 89,372,160 D97G probably damaging Het
Slc25a54 T C 3: 109,094,232 V112A probably benign Het
Slc5a11 A T 7: 123,265,269 K363* probably null Het
Smg1 G T 7: 118,154,661 T2563K unknown Het
Snap47 A T 11: 59,428,464 S283T probably damaging Het
Stat1 G T 1: 52,139,229 R274L probably damaging Het
Stoml1 A G 9: 58,257,126 T166A Het
Svs2 G T 2: 164,237,589 Q133K probably benign Het
Tas2r107 T A 6: 131,659,459 H209L probably benign Het
Tmco3 T A 8: 13,310,228 V477D possibly damaging Het
Tmem131 A T 1: 36,841,686 S168T possibly damaging Het
Tmem41a T C 16: 21,937,109 N149S probably damaging Het
Ttn T A 2: 76,954,818 M784L unknown Het
Ubr1 A G 2: 120,873,122 probably null Het
Ubxn2b C T 4: 6,214,646 P227S probably damaging Het
Upb1 C T 10: 75,430,127 L263F probably benign Het
Usp15 T A 10: 123,113,648 T935S probably benign Het
Zscan4-ps3 G A 7: 11,613,237 C400Y probably damaging Het
Other mutations in Ttll4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Ttll4 APN 1 74685893 missense probably damaging 1.00
IGL01743:Ttll4 APN 1 74688193 missense possibly damaging 0.63
IGL01914:Ttll4 APN 1 74679058 missense probably benign 0.01
IGL02288:Ttll4 APN 1 74679401 missense probably benign 0.05
IGL02621:Ttll4 APN 1 74687484 missense probably damaging 1.00
IGL02662:Ttll4 APN 1 74687231 splice site probably null
IGL02890:Ttll4 APN 1 74687339 nonsense probably null
IGL02937:Ttll4 APN 1 74679503 missense possibly damaging 0.92
IGL03178:Ttll4 APN 1 74680408 missense probably damaging 0.96
IGL03412:Ttll4 APN 1 74687321 missense probably benign 0.28
1mM(1):Ttll4 UTSW 1 74689980 missense probably null 1.00
R0083:Ttll4 UTSW 1 74679769 missense probably benign 0.13
R0108:Ttll4 UTSW 1 74679769 missense probably benign 0.13
R0135:Ttll4 UTSW 1 74679928 missense possibly damaging 0.86
R0137:Ttll4 UTSW 1 74679692 missense possibly damaging 0.74
R0306:Ttll4 UTSW 1 74696757 missense probably benign 0.28
R0506:Ttll4 UTSW 1 74688618 missense probably benign 0.06
R0555:Ttll4 UTSW 1 74688280 missense probably damaging 1.00
R1617:Ttll4 UTSW 1 74679401 missense probably benign 0.05
R1649:Ttll4 UTSW 1 74697470 missense possibly damaging 0.52
R1793:Ttll4 UTSW 1 74687840 missense possibly damaging 0.91
R1898:Ttll4 UTSW 1 74697482 missense probably benign 0.01
R1952:Ttll4 UTSW 1 74687559 missense probably damaging 0.99
R1987:Ttll4 UTSW 1 74685368 missense possibly damaging 0.81
R1989:Ttll4 UTSW 1 74685368 missense possibly damaging 0.81
R2067:Ttll4 UTSW 1 74680382 missense possibly damaging 0.94
R2162:Ttll4 UTSW 1 74686391 missense probably damaging 1.00
R2185:Ttll4 UTSW 1 74679829 missense possibly damaging 0.54
R2875:Ttll4 UTSW 1 74686438 splice site probably null
R2876:Ttll4 UTSW 1 74686438 splice site probably null
R2895:Ttll4 UTSW 1 74685358 missense possibly damaging 0.92
R2896:Ttll4 UTSW 1 74685358 missense possibly damaging 0.92
R3157:Ttll4 UTSW 1 74697611 missense possibly damaging 0.81
R3832:Ttll4 UTSW 1 74686391 missense probably damaging 1.00
R4707:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R4784:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R4785:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R5176:Ttll4 UTSW 1 74679286 missense probably damaging 0.99
R5202:Ttll4 UTSW 1 74687852 critical splice donor site probably null
R5244:Ttll4 UTSW 1 74696448 missense probably benign 0.30
R5264:Ttll4 UTSW 1 74686376 missense possibly damaging 0.92
R5452:Ttll4 UTSW 1 74679321 missense probably benign 0.06
R5992:Ttll4 UTSW 1 74685391 missense probably damaging 1.00
R6111:Ttll4 UTSW 1 74697539 missense possibly damaging 0.95
R6722:Ttll4 UTSW 1 74681789 missense possibly damaging 0.95
R6776:Ttll4 UTSW 1 74681353 missense probably damaging 1.00
R6815:Ttll4 UTSW 1 74679349 missense possibly damaging 0.89
R6836:Ttll4 UTSW 1 74689413 missense probably damaging 0.98
R6963:Ttll4 UTSW 1 74681816 missense probably damaging 1.00
R7271:Ttll4 UTSW 1 74688661 missense possibly damaging 0.83
R7508:Ttll4 UTSW 1 74687259 missense possibly damaging 0.81
R7714:Ttll4 UTSW 1 74679413 missense probably benign 0.00
R7837:Ttll4 UTSW 1 74681757 critical splice acceptor site probably null
R8032:Ttll4 UTSW 1 74696473 missense possibly damaging 0.82
R8036:Ttll4 UTSW 1 74679230 missense probably benign 0.02
R8115:Ttll4 UTSW 1 74687330 nonsense probably null
R8949:Ttll4 UTSW 1 74681816 missense probably damaging 0.99
R9145:Ttll4 UTSW 1 74679790 missense probably benign 0.02
R9329:Ttll4 UTSW 1 74685962 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GATGTCACTGCCCCTATCAC -3'
(R):5'- AGGAGGTGAATGCTGATCCTC -3'

Sequencing Primer
(F):5'- AGTGTTACCTCTTCCCAGTGCAG -3'
(R):5'- GCTGATCCTCTTGGTACAGAAGAC -3'
Posted On 2022-01-20