Incidental Mutation 'R9156:Ubr1'
ID 695357
Institutional Source Beutler Lab
Gene Symbol Ubr1
Ensembl Gene ENSMUSG00000027272
Gene Name ubiquitin protein ligase E3 component n-recognin 1
Synonyms E3 alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.850) question?
Stock # R9156 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 120860269-120970715 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 120873122 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028728]
AlphaFold O70481
Predicted Effect probably null
Transcript: ENSMUST00000028728
SMART Domains Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272

DomainStartEndE-ValueType
ZnF_UBR1 97 167 1.24e-35 SMART
Pfam:ClpS 221 301 8e-24 PFAM
low complexity region 918 936 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
low complexity region 1070 1081 N/A INTRINSIC
Blast:RING 1101 1203 4e-34 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153868
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,670,998 L1150V probably damaging Het
AB124611 A G 9: 21,544,693 D194G possibly damaging Het
Adgrv1 A G 13: 81,521,183 L2418P probably benign Het
Ap3m1 A G 14: 21,040,084 S213P probably damaging Het
Apobec2 A T 17: 48,432,503 L36H Het
Arrb1 A G 7: 99,588,073 D78G Het
Astn1 A G 1: 158,510,985 Q434R probably damaging Het
Cadps C G 14: 12,705,676 D240H probably damaging Het
Cmya5 A C 13: 93,097,370 D403E unknown Het
Crxos A C 7: 15,897,511 I45L probably benign Het
Dmxl1 C G 18: 49,939,572 N2744K probably damaging Het
Dnah2 A G 11: 69,422,861 I4204T Het
Ei24 A G 9: 36,786,031 S134P probably damaging Het
Eif2ak3 G T 6: 70,883,630 V397F probably damaging Het
Eif4g2 T C 7: 111,073,762 I134V Het
Fam186a A G 15: 99,943,278 I1695T possibly damaging Het
Gcnt3 T C 9: 70,034,657 M210V probably damaging Het
Gm21671 CTTT C 5: 25,950,859 probably benign Het
Gm4788 A G 1: 139,732,347 I680T probably damaging Het
Gpatch8 A G 11: 102,479,473 S1080P probably benign Het
Gtf3c1 A G 7: 125,645,777 L1695P possibly damaging Het
Haus3 A G 5: 34,167,650 F222L probably damaging Het
Kbtbd8 C T 6: 95,122,844 Q445* probably null Het
Kcnc3 A G 7: 44,591,168 N95D probably damaging Het
Krt40 C T 11: 99,539,867 probably null Het
Lgi1 A G 19: 38,301,298 T271A probably benign Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Map3k21 A G 8: 125,938,724 T551A possibly damaging Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Mug1 C A 6: 121,874,431 D762E probably damaging Het
Myo1e A T 9: 70,359,323 N615I probably damaging Het
Olfr1280 T C 2: 111,315,482 M1T probably null Het
Olfr564 T C 7: 102,804,132 L218P probably damaging Het
Pld5 T C 1: 175,975,538 E387G possibly damaging Het
Pld5 A G 1: 176,074,437 V195A probably benign Het
Rad54l T C 4: 116,123,152 probably benign Het
Rnf123 A T 9: 108,063,028 probably benign Het
Rnf213 A G 11: 119,440,748 E2262G Het
Rp1 C A 1: 4,163,938 V910L unknown Het
Rpp21 A T 17: 36,257,515 C23S probably benign Het
Scn11a T C 9: 119,759,923 M1306V possibly damaging Het
Scn2b C T 9: 45,125,436 L81F possibly damaging Het
Sco2 T C 15: 89,372,160 D97G probably damaging Het
Slc25a54 T C 3: 109,094,232 V112A probably benign Het
Slc5a11 A T 7: 123,265,269 K363* probably null Het
Smg1 G T 7: 118,154,661 T2563K unknown Het
Snap47 A T 11: 59,428,464 S283T probably damaging Het
Stat1 G T 1: 52,139,229 R274L probably damaging Het
Stoml1 A G 9: 58,257,126 T166A Het
Svs2 G T 2: 164,237,589 Q133K probably benign Het
Tas2r107 T A 6: 131,659,459 H209L probably benign Het
Tmco3 T A 8: 13,310,228 V477D possibly damaging Het
Tmem131 A T 1: 36,841,686 S168T possibly damaging Het
Tmem41a T C 16: 21,937,109 N149S probably damaging Het
Ttll4 T C 1: 74,680,066 F359L probably benign Het
Ttn T A 2: 76,954,818 M784L unknown Het
Ubxn2b C T 4: 6,214,646 P227S probably damaging Het
Upb1 C T 10: 75,430,127 L263F probably benign Het
Usp15 T A 10: 123,113,648 T935S probably benign Het
Zscan4-ps3 G A 7: 11,613,237 C400Y probably damaging Het
Other mutations in Ubr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ubr1 APN 2 120875407 missense possibly damaging 0.65
IGL00570:Ubr1 APN 2 120941093 missense possibly damaging 0.93
IGL00990:Ubr1 APN 2 120930872 missense probably damaging 1.00
IGL01124:Ubr1 APN 2 120914905 missense probably benign
IGL01346:Ubr1 APN 2 120873122 critical splice donor site probably null
IGL01368:Ubr1 APN 2 120941131 splice site probably benign
IGL01539:Ubr1 APN 2 120926013 missense possibly damaging 0.79
IGL01862:Ubr1 APN 2 120934342 missense possibly damaging 0.81
IGL01965:Ubr1 APN 2 120875398 missense probably damaging 0.99
IGL01984:Ubr1 APN 2 120921386 missense probably damaging 0.99
IGL02184:Ubr1 APN 2 120900508 missense probably benign 0.00
IGL02208:Ubr1 APN 2 120946349 missense probably benign 0.00
IGL02415:Ubr1 APN 2 120970603 utr 5 prime probably benign
IGL02517:Ubr1 APN 2 120864373 missense possibly damaging 0.69
IGL02614:Ubr1 APN 2 120870979 splice site probably benign
IGL02627:Ubr1 APN 2 120940991 missense probably damaging 1.00
IGL02718:Ubr1 APN 2 120914883 missense probably damaging 1.00
IGL02741:Ubr1 APN 2 120941091 missense probably benign 0.01
IGL02939:Ubr1 APN 2 120881183 critical splice acceptor site probably null
IGL03081:Ubr1 APN 2 120961156 missense possibly damaging 0.83
IGL03310:Ubr1 APN 2 120864417 missense probably damaging 1.00
IGL03370:Ubr1 APN 2 120895160 missense probably benign
I1329:Ubr1 UTSW 2 120934294 splice site probably benign
R0022:Ubr1 UTSW 2 120961173 splice site probably benign
R0345:Ubr1 UTSW 2 120904103 splice site probably null
R0373:Ubr1 UTSW 2 120946657 missense probably benign 0.01
R0393:Ubr1 UTSW 2 120906946 missense probably damaging 1.00
R0543:Ubr1 UTSW 2 120881093 missense probably damaging 1.00
R0559:Ubr1 UTSW 2 120947883 nonsense probably null
R0723:Ubr1 UTSW 2 120881101 nonsense probably null
R1178:Ubr1 UTSW 2 120926029 nonsense probably null
R1401:Ubr1 UTSW 2 120955644 missense probably benign 0.01
R1485:Ubr1 UTSW 2 120961098 missense probably benign 0.03
R1572:Ubr1 UTSW 2 120935319 splice site probably benign
R1920:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1921:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1997:Ubr1 UTSW 2 120946273 critical splice donor site probably null
R2129:Ubr1 UTSW 2 120942553 missense probably benign 0.35
R2147:Ubr1 UTSW 2 120864330 missense probably damaging 1.00
R2191:Ubr1 UTSW 2 120926047 missense probably damaging 0.96
R2288:Ubr1 UTSW 2 120909482 missense probably damaging 1.00
R3409:Ubr1 UTSW 2 120963448 missense probably benign 0.02
R3930:Ubr1 UTSW 2 120916470 missense probably benign 0.20
R3979:Ubr1 UTSW 2 120862687 missense probably benign 0.11
R4172:Ubr1 UTSW 2 120946622 splice site probably null
R4173:Ubr1 UTSW 2 120946622 splice site probably null
R4174:Ubr1 UTSW 2 120946622 splice site probably null
R4241:Ubr1 UTSW 2 120934386 missense possibly damaging 0.69
R4366:Ubr1 UTSW 2 120970603 utr 5 prime probably benign
R4371:Ubr1 UTSW 2 120895066 splice site probably null
R4449:Ubr1 UTSW 2 120946381 missense possibly damaging 0.84
R4533:Ubr1 UTSW 2 120942482 missense possibly damaging 0.86
R4656:Ubr1 UTSW 2 120926013 missense probably benign 0.35
R4765:Ubr1 UTSW 2 120963442 nonsense probably null
R4928:Ubr1 UTSW 2 120914938 missense probably damaging 1.00
R4987:Ubr1 UTSW 2 120963566 missense probably benign 0.00
R5033:Ubr1 UTSW 2 120911997 critical splice donor site probably null
R5108:Ubr1 UTSW 2 120963422 missense probably benign 0.20
R5118:Ubr1 UTSW 2 120882264 missense probably benign 0.20
R5211:Ubr1 UTSW 2 120893170 missense possibly damaging 0.92
R5215:Ubr1 UTSW 2 120904044 missense probably benign 0.00
R5449:Ubr1 UTSW 2 120963500 missense probably benign
R5452:Ubr1 UTSW 2 120868302 missense possibly damaging 0.95
R5582:Ubr1 UTSW 2 120915407 missense probably benign
R5610:Ubr1 UTSW 2 120892112 missense probably benign 0.04
R5637:Ubr1 UTSW 2 120963517 missense possibly damaging 0.68
R5808:Ubr1 UTSW 2 120961092 missense possibly damaging 0.63
R5845:Ubr1 UTSW 2 120904005 missense probably benign
R5979:Ubr1 UTSW 2 120946382 missense probably benign 0.07
R6044:Ubr1 UTSW 2 120862721 missense probably benign 0.38
R6146:Ubr1 UTSW 2 120893209 missense probably damaging 0.98
R6252:Ubr1 UTSW 2 120906895 missense probably benign 0.21
R6389:Ubr1 UTSW 2 120881039 missense probably benign 0.03
R6600:Ubr1 UTSW 2 120915399 missense probably benign 0.00
R6670:Ubr1 UTSW 2 120924130 critical splice donor site probably null
R6731:Ubr1 UTSW 2 120955640 missense probably null 0.99
R6836:Ubr1 UTSW 2 120896675 splice site probably null
R6994:Ubr1 UTSW 2 120963593 missense probably benign
R7121:Ubr1 UTSW 2 120875498 missense probably benign 0.00
R7204:Ubr1 UTSW 2 120904077 missense possibly damaging 0.49
R7209:Ubr1 UTSW 2 120862765 missense probably benign 0.04
R7434:Ubr1 UTSW 2 120862680 missense probably benign
R7457:Ubr1 UTSW 2 120917828 missense probably benign 0.35
R7464:Ubr1 UTSW 2 120889774 critical splice donor site probably null
R7519:Ubr1 UTSW 2 120875444 missense possibly damaging 0.63
R7574:Ubr1 UTSW 2 120873191 missense possibly damaging 0.93
R8030:Ubr1 UTSW 2 120934374 missense probably damaging 0.99
R8085:Ubr1 UTSW 2 120934417 nonsense probably null
R8221:Ubr1 UTSW 2 120961104 missense probably damaging 0.97
R8241:Ubr1 UTSW 2 120963456 missense possibly damaging 0.80
R8291:Ubr1 UTSW 2 120911115 missense probably benign
R8293:Ubr1 UTSW 2 120862721 missense probably benign 0.38
R8420:Ubr1 UTSW 2 120870995 missense probably benign
R8489:Ubr1 UTSW 2 120881067 missense probably benign 0.42
R8708:Ubr1 UTSW 2 120866483 missense probably benign 0.27
R8856:Ubr1 UTSW 2 120904042 missense probably damaging 1.00
R8995:Ubr1 UTSW 2 120866553 missense probably damaging 1.00
R9153:Ubr1 UTSW 2 120925988 missense probably benign 0.00
R9155:Ubr1 UTSW 2 120924134 missense possibly damaging 0.84
R9194:Ubr1 UTSW 2 120947844 missense probably damaging 1.00
R9320:Ubr1 UTSW 2 120896519 missense probably benign 0.04
R9401:Ubr1 UTSW 2 120935284 missense probably benign 0.06
R9430:Ubr1 UTSW 2 120904025 missense possibly damaging 0.59
R9515:Ubr1 UTSW 2 120873146 missense probably damaging 1.00
R9623:Ubr1 UTSW 2 120934339 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACTGAGAATCTCTGTACGCTCC -3'
(R):5'- TGAAGAGCTCCTTTAACACTGTAG -3'

Sequencing Primer
(F):5'- GGCCACCCTTAGTTACATAGTGAG -3'
(R):5'- CACTGTAGATCAGAATAATGTGCTC -3'
Posted On 2022-01-20