Incidental Mutation 'R9156:Ubxn2b'
ID 695361
Institutional Source Beutler Lab
Gene Symbol Ubxn2b
Ensembl Gene ENSMUSG00000028243
Gene Name UBX domain protein 2B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.355) question?
Stock # R9156 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 6191098-6221688 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 6214646 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 227 (P227S)
Ref Sequence ENSEMBL: ENSMUSP00000029907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029907]
AlphaFold Q0KL01
Predicted Effect probably damaging
Transcript: ENSMUST00000029907
AA Change: P227S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029907
Gene: ENSMUSG00000028243
AA Change: P227S

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
SEP 138 232 3.5e-39 SMART
UBX 251 330 1.05e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,670,998 L1150V probably damaging Het
AB124611 A G 9: 21,544,693 D194G possibly damaging Het
Adgrv1 A G 13: 81,521,183 L2418P probably benign Het
Ap3m1 A G 14: 21,040,084 S213P probably damaging Het
Apobec2 A T 17: 48,432,503 L36H Het
Arrb1 A G 7: 99,588,073 D78G Het
Astn1 A G 1: 158,510,985 Q434R probably damaging Het
Cadps C G 14: 12,705,676 D240H probably damaging Het
Cmya5 A C 13: 93,097,370 D403E unknown Het
Crxos A C 7: 15,897,511 I45L probably benign Het
Dmxl1 C G 18: 49,939,572 N2744K probably damaging Het
Dnah2 A G 11: 69,422,861 I4204T Het
Ei24 A G 9: 36,786,031 S134P probably damaging Het
Eif2ak3 G T 6: 70,883,630 V397F probably damaging Het
Eif4g2 T C 7: 111,073,762 I134V Het
Fam186a A G 15: 99,943,278 I1695T possibly damaging Het
Gcnt3 T C 9: 70,034,657 M210V probably damaging Het
Gm21671 CTTT C 5: 25,950,859 probably benign Het
Gm4788 A G 1: 139,732,347 I680T probably damaging Het
Gpatch8 A G 11: 102,479,473 S1080P probably benign Het
Gtf3c1 A G 7: 125,645,777 L1695P possibly damaging Het
Haus3 A G 5: 34,167,650 F222L probably damaging Het
Kbtbd8 C T 6: 95,122,844 Q445* probably null Het
Kcnc3 A G 7: 44,591,168 N95D probably damaging Het
Krt40 C T 11: 99,539,867 probably null Het
Lgi1 A G 19: 38,301,298 T271A probably benign Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Map3k21 A G 8: 125,938,724 T551A possibly damaging Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Mug1 C A 6: 121,874,431 D762E probably damaging Het
Myo1e A T 9: 70,359,323 N615I probably damaging Het
Olfr1280 T C 2: 111,315,482 M1T probably null Het
Olfr564 T C 7: 102,804,132 L218P probably damaging Het
Pld5 T C 1: 175,975,538 E387G possibly damaging Het
Pld5 A G 1: 176,074,437 V195A probably benign Het
Rad54l T C 4: 116,123,152 probably benign Het
Rnf123 A T 9: 108,063,028 probably benign Het
Rnf213 A G 11: 119,440,748 E2262G Het
Rp1 C A 1: 4,163,938 V910L unknown Het
Rpp21 A T 17: 36,257,515 C23S probably benign Het
Scn11a T C 9: 119,759,923 M1306V possibly damaging Het
Scn2b C T 9: 45,125,436 L81F possibly damaging Het
Sco2 T C 15: 89,372,160 D97G probably damaging Het
Slc25a54 T C 3: 109,094,232 V112A probably benign Het
Slc5a11 A T 7: 123,265,269 K363* probably null Het
Smg1 G T 7: 118,154,661 T2563K unknown Het
Snap47 A T 11: 59,428,464 S283T probably damaging Het
Stat1 G T 1: 52,139,229 R274L probably damaging Het
Stoml1 A G 9: 58,257,126 T166A Het
Svs2 G T 2: 164,237,589 Q133K probably benign Het
Tas2r107 T A 6: 131,659,459 H209L probably benign Het
Tmco3 T A 8: 13,310,228 V477D possibly damaging Het
Tmem131 A T 1: 36,841,686 S168T possibly damaging Het
Tmem41a T C 16: 21,937,109 N149S probably damaging Het
Ttll4 T C 1: 74,680,066 F359L probably benign Het
Ttn T A 2: 76,954,818 M784L unknown Het
Ubr1 A G 2: 120,873,122 probably null Het
Upb1 C T 10: 75,430,127 L263F probably benign Het
Usp15 T A 10: 123,113,648 T935S probably benign Het
Zscan4-ps3 G A 7: 11,613,237 C400Y probably damaging Het
Other mutations in Ubxn2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01912:Ubxn2b APN 4 6203767 splice site probably null
IGL02096:Ubxn2b APN 4 6214749 missense probably damaging 1.00
IGL02272:Ubxn2b APN 4 6216071 missense probably damaging 1.00
R0081:Ubxn2b UTSW 4 6203875 splice site probably benign
R0482:Ubxn2b UTSW 4 6196404 splice site probably null
R1903:Ubxn2b UTSW 4 6208889 missense possibly damaging 0.82
R4206:Ubxn2b UTSW 4 6204565 missense probably damaging 0.99
R5071:Ubxn2b UTSW 4 6214746 missense probably damaging 1.00
R7622:Ubxn2b UTSW 4 6214692 missense probably damaging 0.98
R8034:Ubxn2b UTSW 4 6191167 missense probably benign 0.06
R8836:Ubxn2b UTSW 4 6216061 missense probably damaging 1.00
R9413:Ubxn2b UTSW 4 6204607 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGAAGGCAGTAGTAAGCTG -3'
(R):5'- TCAATATGCTTTGTGCGCTGTC -3'

Sequencing Primer
(F):5'- TAAGCTGGAAGGAGGCTGTGTC -3'
(R):5'- CGCTGTCCTGTGGATGAAACAG -3'
Posted On 2022-01-20