Incidental Mutation 'R9156:Scn11a'
ID 695388
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Name sodium channel, voltage-gated, type XI, alpha
Synonyms NaN, NSS2, NaT, SNS2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock # R9156 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 119753759-119825456 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119759923 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 1306 (M1306V)
Ref Sequence ENSEMBL: ENSMUSP00000065466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
AlphaFold Q9R053
Predicted Effect possibly damaging
Transcript: ENSMUST00000070617
AA Change: M1306V

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: M1306V

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000215718
AA Change: M1306V

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,670,998 L1150V probably damaging Het
AB124611 A G 9: 21,544,693 D194G possibly damaging Het
Adgrv1 A G 13: 81,521,183 L2418P probably benign Het
Ap3m1 A G 14: 21,040,084 S213P probably damaging Het
Apobec2 A T 17: 48,432,503 L36H Het
Arrb1 A G 7: 99,588,073 D78G Het
Astn1 A G 1: 158,510,985 Q434R probably damaging Het
Cadps C G 14: 12,705,676 D240H probably damaging Het
Cmya5 A C 13: 93,097,370 D403E unknown Het
Crxos A C 7: 15,897,511 I45L probably benign Het
Dmxl1 C G 18: 49,939,572 N2744K probably damaging Het
Dnah2 A G 11: 69,422,861 I4204T Het
Ei24 A G 9: 36,786,031 S134P probably damaging Het
Eif2ak3 G T 6: 70,883,630 V397F probably damaging Het
Eif4g2 T C 7: 111,073,762 I134V Het
Fam186a A G 15: 99,943,278 I1695T possibly damaging Het
Gcnt3 T C 9: 70,034,657 M210V probably damaging Het
Gm21671 CTTT C 5: 25,950,859 probably benign Het
Gm4788 A G 1: 139,732,347 I680T probably damaging Het
Gpatch8 A G 11: 102,479,473 S1080P probably benign Het
Gtf3c1 A G 7: 125,645,777 L1695P possibly damaging Het
Haus3 A G 5: 34,167,650 F222L probably damaging Het
Kbtbd8 C T 6: 95,122,844 Q445* probably null Het
Kcnc3 A G 7: 44,591,168 N95D probably damaging Het
Krt40 C T 11: 99,539,867 probably null Het
Lgi1 A G 19: 38,301,298 T271A probably benign Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Map3k21 A G 8: 125,938,724 T551A possibly damaging Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Mug1 C A 6: 121,874,431 D762E probably damaging Het
Myo1e A T 9: 70,359,323 N615I probably damaging Het
Olfr1280 T C 2: 111,315,482 M1T probably null Het
Olfr564 T C 7: 102,804,132 L218P probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pld5 A G 1: 176,074,437 V195A probably benign Het
Pld5 T C 1: 175,975,538 E387G possibly damaging Het
Rad54l T C 4: 116,123,152 probably benign Het
Rnf213 A G 11: 119,440,748 E2262G Het
Rp1 C A 1: 4,163,938 V910L unknown Het
Scn2b C T 9: 45,125,436 L81F possibly damaging Het
Sco2 T C 15: 89,372,160 D97G probably damaging Het
Slc25a54 T C 3: 109,094,232 V112A probably benign Het
Slc5a11 A T 7: 123,265,269 K363* probably null Het
Smg1 G T 7: 118,154,661 T2563K unknown Het
Snap47 A T 11: 59,428,464 S283T probably damaging Het
Stat1 G T 1: 52,139,229 R274L probably damaging Het
Stoml1 A G 9: 58,257,126 T166A Het
Svs2 G T 2: 164,237,589 Q133K probably benign Het
Tas2r107 T A 6: 131,659,459 H209L probably benign Het
Tmco3 T A 8: 13,310,228 V477D possibly damaging Het
Tmem131 A T 1: 36,841,686 S168T possibly damaging Het
Tmem41a T C 16: 21,937,109 N149S probably damaging Het
Ttll4 T C 1: 74,680,066 F359L probably benign Het
Ttn T A 2: 76,954,818 M784L unknown Het
Ubr1 A G 2: 120,873,122 probably null Het
Ubxn2b C T 4: 6,214,646 P227S probably damaging Het
Upb1 C T 10: 75,430,127 L263F probably benign Het
Usp15 T A 10: 123,113,648 T935S probably benign Het
Zscan4-ps3 G A 7: 11,613,237 C400Y probably damaging Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119770506 missense probably benign 0.00
IGL00272:Scn11a APN 9 119816603 missense probably damaging 0.98
IGL00332:Scn11a APN 9 119769916 missense probably damaging 1.00
IGL00533:Scn11a APN 9 119774381 missense probably damaging 1.00
IGL00972:Scn11a APN 9 119793938 missense probably benign 0.44
IGL01338:Scn11a APN 9 119784161 splice site probably benign
IGL01534:Scn11a APN 9 119780822 missense probably benign 0.27
IGL01838:Scn11a APN 9 119758583 missense probably damaging 1.00
IGL01991:Scn11a APN 9 119819904 missense probably damaging 0.97
IGL02057:Scn11a APN 9 119765470 missense probably damaging 1.00
IGL02290:Scn11a APN 9 119774442 missense probably damaging 0.97
IGL02454:Scn11a APN 9 119758544 missense probably benign 0.00
IGL02517:Scn11a APN 9 119792398 missense probably damaging 1.00
IGL02567:Scn11a APN 9 119804489 missense probably damaging 0.99
IGL02587:Scn11a APN 9 119805684 missense probably damaging 1.00
IGL03069:Scn11a APN 9 119789963 missense probably benign 0.16
IGL03171:Scn11a APN 9 119819847 missense probably benign 0.00
Kleinie UTSW 9 119803503 missense probably benign 0.16
H8441:Scn11a UTSW 9 119807910 missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119769948 missense probably damaging 1.00
R0304:Scn11a UTSW 9 119819862 missense probably benign 0.00
R0519:Scn11a UTSW 9 119790119 missense probably damaging 1.00
R0658:Scn11a UTSW 9 119811160 missense probably benign 0.41
R0828:Scn11a UTSW 9 119755007 missense probably benign 0.00
R0893:Scn11a UTSW 9 119803330 splice site probably null
R0932:Scn11a UTSW 9 119807810 missense probably damaging 1.00
R1061:Scn11a UTSW 9 119795663 missense probably damaging 0.98
R1161:Scn11a UTSW 9 119755057 nonsense probably null
R1162:Scn11a UTSW 9 119805644 splice site probably benign
R1310:Scn11a UTSW 9 119755057 nonsense probably null
R1589:Scn11a UTSW 9 119769807 missense probably damaging 1.00
R1681:Scn11a UTSW 9 119804412 missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119755082 missense probably damaging 1.00
R1812:Scn11a UTSW 9 119780865 nonsense probably null
R1901:Scn11a UTSW 9 119779036 nonsense probably null
R1978:Scn11a UTSW 9 119780795 nonsense probably null
R1985:Scn11a UTSW 9 119754678 missense probably benign 0.19
R2022:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119792494 missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119755025 missense probably damaging 1.00
R2250:Scn11a UTSW 9 119758602 missense probably benign 0.01
R2373:Scn11a UTSW 9 119813186 missense probably benign 0.43
R2508:Scn11a UTSW 9 119765529 missense probably damaging 1.00
R3757:Scn11a UTSW 9 119803503 missense probably benign 0.16
R3767:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R3770:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R4089:Scn11a UTSW 9 119795653 splice site probably null
R4092:Scn11a UTSW 9 119789970 missense probably benign 0.03
R4247:Scn11a UTSW 9 119807886 missense probably damaging 1.00
R4279:Scn11a UTSW 9 119754362 missense probably benign 0.25
R4299:Scn11a UTSW 9 119765506 missense probably damaging 0.97
R4403:Scn11a UTSW 9 119795667 missense probably damaging 1.00
R4468:Scn11a UTSW 9 119754987 missense probably damaging 1.00
R4542:Scn11a UTSW 9 119755134 missense probably damaging 1.00
R4644:Scn11a UTSW 9 119815203 splice site probably null
R4739:Scn11a UTSW 9 119754561 missense probably benign 0.39
R4809:Scn11a UTSW 9 119819870 missense probably benign 0.00
R4954:Scn11a UTSW 9 119758659 missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119780878 missense probably benign 0.31
R5044:Scn11a UTSW 9 119819831 missense probably damaging 0.98
R5222:Scn11a UTSW 9 119815202 splice site probably null
R5224:Scn11a UTSW 9 119754792 missense probably damaging 1.00
R5400:Scn11a UTSW 9 119769908 missense probably damaging 0.97
R5555:Scn11a UTSW 9 119755238 missense probably damaging 1.00
R5711:Scn11a UTSW 9 119789924 missense probably damaging 1.00
R5950:Scn11a UTSW 9 119811124 missense probably damaging 1.00
R5984:Scn11a UTSW 9 119784016 missense probably benign
R6057:Scn11a UTSW 9 119765448 missense probably damaging 1.00
R6104:Scn11a UTSW 9 119795678 missense probably damaging 1.00
R6180:Scn11a UTSW 9 119754867 missense probably benign 0.00
R6892:Scn11a UTSW 9 119806969 missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119792426 missense probably damaging 1.00
R6949:Scn11a UTSW 9 119765514 missense probably benign 0.04
R7112:Scn11a UTSW 9 119754809 missense probably damaging 1.00
R7232:Scn11a UTSW 9 119759916 missense probably damaging 1.00
R7261:Scn11a UTSW 9 119819833 missense probably damaging 0.99
R7265:Scn11a UTSW 9 119815265 missense probably damaging 1.00
R7302:Scn11a UTSW 9 119806951 missense probably benign 0.03
R7391:Scn11a UTSW 9 119795717 missense probably damaging 1.00
R7441:Scn11a UTSW 9 119758626 missense probably benign 0.01
R7479:Scn11a UTSW 9 119759875 missense probably benign 0.38
R7608:Scn11a UTSW 9 119815313 splice site probably null
R7768:Scn11a UTSW 9 119815272 missense probably benign 0.13
R7785:Scn11a UTSW 9 119816556 missense probably benign 0.00
R7794:Scn11a UTSW 9 119765514 missense probably damaging 0.99
R7818:Scn11a UTSW 9 119784111 missense probably damaging 0.97
R7884:Scn11a UTSW 9 119804551 missense probably benign 0.01
R7988:Scn11a UTSW 9 119765437 missense probably damaging 0.97
R8049:Scn11a UTSW 9 119755083 missense probably damaging 1.00
R8127:Scn11a UTSW 9 119804512 missense probably damaging 1.00
R8274:Scn11a UTSW 9 119803482 missense probably benign
R8344:Scn11a UTSW 9 119781970 missense probably benign 0.00
R8346:Scn11a UTSW 9 119778981 missense probably damaging 1.00
R8511:Scn11a UTSW 9 119789915 missense probably damaging 0.99
R8819:Scn11a UTSW 9 119816520 missense probably benign 0.19
R8820:Scn11a UTSW 9 119816520 missense probably benign 0.19
R8837:Scn11a UTSW 9 119792344 missense probably damaging 1.00
R8913:Scn11a UTSW 9 119794028 missense probably damaging 1.00
R8915:Scn11a UTSW 9 119774297 nonsense probably null
R8975:Scn11a UTSW 9 119758499 missense probably damaging 1.00
R9222:Scn11a UTSW 9 119781947 missense probably damaging 0.98
R9355:Scn11a UTSW 9 119755094 missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119755242 missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119754998 missense possibly damaging 0.94
Z1177:Scn11a UTSW 9 119819820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTTTAAGCATTAACAGGAGGC -3'
(R):5'- GAATGACATGACCTCATTCCTCC -3'

Sequencing Primer
(F):5'- ACAGGAGGCTTTTTAGAACCCTG -3'
(R):5'- ATCAATTTTCCTTCTGGTTCCAGAG -3'
Posted On 2022-01-20