Incidental Mutation 'R9156:Snap47'
ID 695391
Institutional Source Beutler Lab
Gene Symbol Snap47
Ensembl Gene ENSMUSG00000009894
Gene Name synaptosomal-associated protein, 47
Synonyms SNAP-47, 1110031B06Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9156 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 59407134-59451186 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 59428464 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 283 (S283T)
Ref Sequence ENSEMBL: ENSMUSP00000010038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010038] [ENSMUST00000120940] [ENSMUST00000136436] [ENSMUST00000156146]
AlphaFold Q8R570
Predicted Effect probably damaging
Transcript: ENSMUST00000010038
AA Change: S283T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000010038
Gene: ENSMUSG00000009894
AA Change: S283T

DomainStartEndE-ValueType
coiled coil region 125 173 N/A INTRINSIC
SCOP:d1fpza_ 181 234 3e-3 SMART
low complexity region 335 349 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120940
AA Change: S283T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113555
Gene: ENSMUSG00000009894
AA Change: S283T

DomainStartEndE-ValueType
coiled coil region 125 173 N/A INTRINSIC
SCOP:d1fpza_ 181 234 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136436
SMART Domains Protein: ENSMUSP00000115762
Gene: ENSMUSG00000009894

DomainStartEndE-ValueType
coiled coil region 125 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156146
SMART Domains Protein: ENSMUSP00000121880
Gene: ENSMUSG00000009894

DomainStartEndE-ValueType
coiled coil region 125 173 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,670,998 L1150V probably damaging Het
AB124611 A G 9: 21,544,693 D194G possibly damaging Het
Adgrv1 A G 13: 81,521,183 L2418P probably benign Het
Ap3m1 A G 14: 21,040,084 S213P probably damaging Het
Apobec2 A T 17: 48,432,503 L36H Het
Arrb1 A G 7: 99,588,073 D78G Het
Astn1 A G 1: 158,510,985 Q434R probably damaging Het
Cadps C G 14: 12,705,676 D240H probably damaging Het
Cmya5 A C 13: 93,097,370 D403E unknown Het
Crxos A C 7: 15,897,511 I45L probably benign Het
Dmxl1 C G 18: 49,939,572 N2744K probably damaging Het
Dnah2 A G 11: 69,422,861 I4204T Het
Ei24 A G 9: 36,786,031 S134P probably damaging Het
Eif2ak3 G T 6: 70,883,630 V397F probably damaging Het
Eif4g2 T C 7: 111,073,762 I134V Het
Fam186a A G 15: 99,943,278 I1695T possibly damaging Het
Gcnt3 T C 9: 70,034,657 M210V probably damaging Het
Gm21671 CTTT C 5: 25,950,859 probably benign Het
Gm4788 A G 1: 139,732,347 I680T probably damaging Het
Gpatch8 A G 11: 102,479,473 S1080P probably benign Het
Gtf3c1 A G 7: 125,645,777 L1695P possibly damaging Het
Haus3 A G 5: 34,167,650 F222L probably damaging Het
Kbtbd8 C T 6: 95,122,844 Q445* probably null Het
Kcnc3 A G 7: 44,591,168 N95D probably damaging Het
Krt40 C T 11: 99,539,867 probably null Het
Lgi1 A G 19: 38,301,298 T271A probably benign Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Map3k21 A G 8: 125,938,724 T551A possibly damaging Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Mug1 C A 6: 121,874,431 D762E probably damaging Het
Myo1e A T 9: 70,359,323 N615I probably damaging Het
Olfr1280 T C 2: 111,315,482 M1T probably null Het
Olfr564 T C 7: 102,804,132 L218P probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pld5 T C 1: 175,975,538 E387G possibly damaging Het
Pld5 A G 1: 176,074,437 V195A probably benign Het
Rad54l T C 4: 116,123,152 probably benign Het
Rnf213 A G 11: 119,440,748 E2262G Het
Rp1 C A 1: 4,163,938 V910L unknown Het
Scn11a T C 9: 119,759,923 M1306V possibly damaging Het
Scn2b C T 9: 45,125,436 L81F possibly damaging Het
Sco2 T C 15: 89,372,160 D97G probably damaging Het
Slc25a54 T C 3: 109,094,232 V112A probably benign Het
Slc5a11 A T 7: 123,265,269 K363* probably null Het
Smg1 G T 7: 118,154,661 T2563K unknown Het
Stat1 G T 1: 52,139,229 R274L probably damaging Het
Stoml1 A G 9: 58,257,126 T166A Het
Svs2 G T 2: 164,237,589 Q133K probably benign Het
Tas2r107 T A 6: 131,659,459 H209L probably benign Het
Tmco3 T A 8: 13,310,228 V477D possibly damaging Het
Tmem131 A T 1: 36,841,686 S168T possibly damaging Het
Tmem41a T C 16: 21,937,109 N149S probably damaging Het
Ttll4 T C 1: 74,680,066 F359L probably benign Het
Ttn T A 2: 76,954,818 M784L unknown Het
Ubr1 A G 2: 120,873,122 probably null Het
Ubxn2b C T 4: 6,214,646 P227S probably damaging Het
Upb1 C T 10: 75,430,127 L263F probably benign Het
Usp15 T A 10: 123,113,648 T935S probably benign Het
Zscan4-ps3 G A 7: 11,613,237 C400Y probably damaging Het
Other mutations in Snap47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01777:Snap47 APN 11 59421651 critical splice acceptor site probably null
IGL02113:Snap47 APN 11 59428436 missense probably damaging 0.99
IGL03290:Snap47 APN 11 59428598 missense probably damaging 1.00
R0126:Snap47 UTSW 11 59437987 missense probably damaging 0.99
R0582:Snap47 UTSW 11 59428433 nonsense probably null
R0633:Snap47 UTSW 11 59428613 missense probably benign 0.25
R0883:Snap47 UTSW 11 59438500 utr 5 prime probably benign
R1657:Snap47 UTSW 11 59428770 missense probably benign 0.08
R1855:Snap47 UTSW 11 59428333 unclassified probably benign
R2761:Snap47 UTSW 11 59438059 missense probably benign 0.01
R4079:Snap47 UTSW 11 59428551 missense probably benign 0.38
R4805:Snap47 UTSW 11 59428517 missense possibly damaging 0.91
R4960:Snap47 UTSW 11 59428543 missense probably damaging 1.00
R5212:Snap47 UTSW 11 59428352 missense probably damaging 0.99
R5793:Snap47 UTSW 11 59438192 missense probably damaging 1.00
R7243:Snap47 UTSW 11 59428722 missense probably benign 0.04
R7603:Snap47 UTSW 11 59428547 missense probably damaging 1.00
R7870:Snap47 UTSW 11 59438078 missense probably benign 0.11
R8001:Snap47 UTSW 11 59438354 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GCCTGCTGAACACGAATCAC -3'
(R):5'- GAGAGCAGAGTCTCATTCCAAGC -3'

Sequencing Primer
(F):5'- CACGAATCACAGCATGCTGAGTG -3'
(R):5'- CTCCTGCACAGATTTGAG -3'
Posted On 2022-01-20