Incidental Mutation 'R9157:1700006A11Rik'
ID 695420
Institutional Source Beutler Lab
Gene Symbol 1700006A11Rik
Ensembl Gene ENSMUSG00000027973
Gene Name RIKEN cDNA 1700006A11 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R9157 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 124400989-124426040 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 124413571 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 324 (T324A)
Ref Sequence ENSEMBL: ENSMUSP00000029598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029598] [ENSMUST00000198630]
AlphaFold B9EHI3
Predicted Effect probably benign
Transcript: ENSMUST00000029598
AA Change: T324A

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029598
Gene: ENSMUSG00000027973
AA Change: T324A

DomainStartEndE-ValueType
RhoGAP 78 251 3.63e-37 SMART
RhoGAP 377 543 3.19e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198630
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T A 14: 8,518,635 T274S probably benign Het
Adam9 A T 8: 25,003,315 F92L probably damaging Het
Adgrb1 A G 15: 74,539,775 T376A probably damaging Het
Aff3 A C 1: 38,210,478 I516S probably benign Het
Bdp1 C T 13: 100,049,928 S1672N probably benign Het
Btc A T 5: 91,366,121 I94N probably damaging Het
Ccdc47 A T 11: 106,202,382 probably null Het
Ceacam5 A T 7: 17,759,494 Y814F possibly damaging Het
Celsr3 A T 9: 108,829,986 R1223W probably damaging Het
Cenpc1 A G 5: 86,018,457 M779T probably benign Het
Depdc5 T C 5: 32,945,108 I986T probably damaging Het
Dhx40 A T 11: 86,771,224 I669N probably damaging Het
Dnah1 T A 14: 31,266,013 I3483F probably damaging Het
Dzip3 C T 16: 48,927,761 G918D probably benign Het
Fam185a T G 5: 21,455,839 V284G probably damaging Het
Fhod3 T C 18: 25,085,594 S805P probably damaging Het
Filip1l A G 16: 57,571,617 N856S probably benign Het
Gm12887 C T 4: 121,616,504 V50M probably benign Het
Gm45785 T C 7: 140,818,703 I94V unknown Het
Gm8251 A G 1: 44,057,360 V1526A probably benign Het
Gm9195 A G 14: 72,454,598 I1616T unknown Het
Grm4 T A 17: 27,434,982 I665F probably benign Het
Hcls1 C T 16: 36,956,638 A230V probably benign Het
Hic1 A G 11: 75,166,227 L612P possibly damaging Het
Hmcn1 A C 1: 150,646,592 V3519G probably benign Het
Hmgcs1 A G 13: 119,704,427 Y360C probably benign Het
Hspa12a A T 19: 58,800,860 M448K possibly damaging Het
Htt T G 5: 34,829,827 I1130S probably null Het
Irx3 A G 8: 91,801,066 Y59H probably damaging Het
Klc4 A G 17: 46,639,435 L280P probably damaging Het
Lrp1 G T 10: 127,574,340 N1512K probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Marco T C 1: 120,494,085 E130G probably damaging Het
Mdga1 G A 17: 29,838,517 T775M probably damaging Het
Ms4a18 A T 19: 11,011,440 L184Q probably damaging Het
Msi2 A C 11: 88,718,063 S10A probably benign Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Ngfr AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG 11: 95,587,490 probably benign Het
Nradd A G 9: 110,622,120 L60P probably damaging Het
Nup188 A G 2: 30,298,444 Y39C probably benign Het
Odf2 G T 2: 29,926,803 G754C probably benign Het
Olfr105-ps A G 17: 37,383,292 M242V probably benign Het
Olfr1270 A G 2: 90,149,178 I276T possibly damaging Het
Olfr270 A G 4: 52,971,419 Y266C possibly damaging Het
Olfr714 A T 7: 107,074,007 M60L probably damaging Het
Osbpl6 C T 2: 76,552,124 P222S probably benign Het
Pcdhga3 T C 18: 37,676,176 Y561H probably benign Het
Phykpl G A 11: 51,599,548 V419I probably benign Het
Pskh1 A G 8: 105,913,510 Y274C possibly damaging Het
Rap1gap G T 4: 137,717,431 V219F probably damaging Het
Rapgef4 C A 2: 72,174,868 H220N probably benign Het
Rcor3 G T 1: 192,125,881 H165Q possibly damaging Het
Reg3d T C 6: 78,377,439 T60A possibly damaging Het
Rgs9 T A 11: 109,225,723 D644V probably damaging Het
Rhob T A 12: 8,499,319 H105L probably benign Het
Rph3a T C 5: 120,963,829 K115E probably damaging Het
Rsf1 GG GGGGACGGCCG 7: 97,579,906 probably benign Het
Scn4b T A 9: 45,146,715 V35E probably damaging Het
Serpina3i T C 12: 104,265,413 I103T probably damaging Het
Sidt2 T C 9: 45,941,360 T776A possibly damaging Het
Slc15a1 T C 14: 121,464,977 I586V probably benign Het
Slc15a5 A T 6: 137,984,458 V213E Het
Stard13 C A 5: 151,233,687 A10S probably benign Het
Taf6 C A 5: 138,180,959 V406F possibly damaging Het
Tap2 G T 17: 34,212,030 R368L possibly damaging Het
Tmem236 T C 2: 14,219,078 V226A probably benign Het
Tmem87a T A 2: 120,379,612 I287F possibly damaging Het
Ttll13 A T 7: 80,254,680 K351I possibly damaging Het
Ttn T A 2: 76,750,901 Y23216F probably damaging Het
Vmn2r27 T C 6: 124,224,285 T238A probably benign Het
Vmn2r54 T C 7: 12,632,128 Y293C possibly damaging Het
Vsig10l T C 7: 43,463,524 S69P Het
Wdr83 G A 8: 85,079,803 T122I probably damaging Het
Zfp219 A G 14: 52,008,743 V309A probably damaging Het
Zfp354a C T 11: 51,069,961 S332F probably damaging Het
Zfp354b T C 11: 50,923,060 N346S possibly damaging Het
Other mutations in 1700006A11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:1700006A11Rik APN 3 124401409 missense probably benign 0.30
IGL02552:1700006A11Rik APN 3 124414496 missense probably damaging 1.00
IGL03092:1700006A11Rik APN 3 124406470 missense probably damaging 1.00
R0094:1700006A11Rik UTSW 3 124409778 splice site probably benign
R0097:1700006A11Rik UTSW 3 124412480 missense probably benign 0.13
R0097:1700006A11Rik UTSW 3 124412480 missense probably benign 0.13
R0184:1700006A11Rik UTSW 3 124419250 missense probably damaging 1.00
R0361:1700006A11Rik UTSW 3 124413634 missense possibly damaging 0.69
R1542:1700006A11Rik UTSW 3 124414406 missense possibly damaging 0.95
R1549:1700006A11Rik UTSW 3 124416792 missense probably benign 0.00
R1779:1700006A11Rik UTSW 3 124406514 missense probably damaging 0.99
R1839:1700006A11Rik UTSW 3 124409720 missense probably damaging 0.99
R1986:1700006A11Rik UTSW 3 124419328 missense probably damaging 0.99
R2042:1700006A11Rik UTSW 3 124416728 splice site probably benign
R2149:1700006A11Rik UTSW 3 124409686 missense probably benign 0.33
R2258:1700006A11Rik UTSW 3 124413618 missense possibly damaging 0.84
R2291:1700006A11Rik UTSW 3 124413801 missense probably damaging 1.00
R2509:1700006A11Rik UTSW 3 124406453 missense probably benign 0.44
R4912:1700006A11Rik UTSW 3 124419856 missense possibly damaging 0.68
R5074:1700006A11Rik UTSW 3 124416833 missense probably benign 0.01
R5303:1700006A11Rik UTSW 3 124406350 missense probably damaging 1.00
R5307:1700006A11Rik UTSW 3 124406350 missense probably damaging 1.00
R5308:1700006A11Rik UTSW 3 124406350 missense probably damaging 1.00
R5796:1700006A11Rik UTSW 3 124421428 missense possibly damaging 0.66
R6018:1700006A11Rik UTSW 3 124416799 missense probably damaging 1.00
R6198:1700006A11Rik UTSW 3 124416850 splice site probably null
R6504:1700006A11Rik UTSW 3 124419920 missense probably benign
R7124:1700006A11Rik UTSW 3 124414393 missense probably benign 0.04
R7248:1700006A11Rik UTSW 3 124414310 critical splice donor site probably null
R7351:1700006A11Rik UTSW 3 124412510 missense probably damaging 1.00
R7709:1700006A11Rik UTSW 3 124407685 missense probably damaging 1.00
R7773:1700006A11Rik UTSW 3 124412531 missense probably benign 0.00
R8193:1700006A11Rik UTSW 3 124419868 missense possibly damaging 0.84
R8201:1700006A11Rik UTSW 3 124401397 missense probably benign 0.00
R9313:1700006A11Rik UTSW 3 124413571 missense probably benign 0.22
R9585:1700006A11Rik UTSW 3 124406344 missense possibly damaging 0.73
R9683:1700006A11Rik UTSW 3 124406446 missense probably benign 0.01
R9721:1700006A11Rik UTSW 3 124419283 missense probably benign 0.00
X0063:1700006A11Rik UTSW 3 124419862 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTTTTACATATACTCAGGACCAC -3'
(R):5'- TATGATGCAAGCTCAGTGTCTTG -3'

Sequencing Primer
(F):5'- GGGGATAAAAATTTACAGGCAGTTTC -3'
(R):5'- CTTGCCCTGATGTGGAGAAAGC -3'
Posted On 2022-01-20