Incidental Mutation 'R9157:Slc15a1'
ID 695470
Institutional Source Beutler Lab
Gene Symbol Slc15a1
Ensembl Gene ENSMUSG00000025557
Gene Name solute carrier family 15 (oligopeptide transporter), member 1
Synonyms PECT1, PEPT1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R9157 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 121459621-121505252 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121464977 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 586 (I586V)
Ref Sequence ENSEMBL: ENSMUSP00000085728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088386]
AlphaFold Q9JIP7
Predicted Effect probably benign
Transcript: ENSMUST00000088386
AA Change: I586V

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000085728
Gene: ENSMUSG00000025557
AA Change: I586V

DomainStartEndE-ValueType
Pfam:PTR2 81 477 1.9e-141 PFAM
Pfam:PTR2 562 644 4.2e-11 PFAM
transmembrane domain 650 672 N/A INTRINSIC
low complexity region 684 695 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intestinal hydrogen peptide cotransporter that is a member of the solute carrier family 15. The encoded protein is localized to the brush border membrane of the intestinal epithelium and mediates the uptake of di- and tripeptides from the lumen into the enterocytes. This protein plays an important role in the uptake and digestion of dietary proteins. This protein also facilitates the absorption of numerous peptidomimetic drugs. [provided by RefSeq, Apr 2010]
PHENOTYPE: Peptide uptake in the intestine is substantially reduced in mice homozygous for a null mutation of this gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,413,571 T324A probably benign Het
4930452B06Rik T A 14: 8,518,635 T274S probably benign Het
Adam9 A T 8: 25,003,315 F92L probably damaging Het
Adgrb1 A G 15: 74,539,775 T376A probably damaging Het
Aff3 A C 1: 38,210,478 I516S probably benign Het
Bdp1 C T 13: 100,049,928 S1672N probably benign Het
Btc A T 5: 91,366,121 I94N probably damaging Het
Ccdc47 A T 11: 106,202,382 probably null Het
Ceacam5 A T 7: 17,759,494 Y814F possibly damaging Het
Celsr3 A T 9: 108,829,986 R1223W probably damaging Het
Cenpc1 A G 5: 86,018,457 M779T probably benign Het
Depdc5 T C 5: 32,945,108 I986T probably damaging Het
Dhx40 A T 11: 86,771,224 I669N probably damaging Het
Dnah1 T A 14: 31,266,013 I3483F probably damaging Het
Dzip3 C T 16: 48,927,761 G918D probably benign Het
Fam185a T G 5: 21,455,839 V284G probably damaging Het
Fhod3 T C 18: 25,085,594 S805P probably damaging Het
Filip1l A G 16: 57,571,617 N856S probably benign Het
Gm12887 C T 4: 121,616,504 V50M probably benign Het
Gm45785 T C 7: 140,818,703 I94V unknown Het
Gm8251 A G 1: 44,057,360 V1526A probably benign Het
Gm9195 A G 14: 72,454,598 I1616T unknown Het
Grm4 T A 17: 27,434,982 I665F probably benign Het
Hcls1 C T 16: 36,956,638 A230V probably benign Het
Hic1 A G 11: 75,166,227 L612P possibly damaging Het
Hmcn1 A C 1: 150,646,592 V3519G probably benign Het
Hmgcs1 A G 13: 119,704,427 Y360C probably benign Het
Hspa12a A T 19: 58,800,860 M448K possibly damaging Het
Htt T G 5: 34,829,827 I1130S probably null Het
Irx3 A G 8: 91,801,066 Y59H probably damaging Het
Klc4 A G 17: 46,639,435 L280P probably damaging Het
Lrp1 G T 10: 127,574,340 N1512K probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Marco T C 1: 120,494,085 E130G probably damaging Het
Mdga1 G A 17: 29,838,517 T775M probably damaging Het
Ms4a18 A T 19: 11,011,440 L184Q probably damaging Het
Msi2 A C 11: 88,718,063 S10A probably benign Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Ngfr AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG 11: 95,587,490 probably benign Het
Nradd A G 9: 110,622,120 L60P probably damaging Het
Nup188 A G 2: 30,298,444 Y39C probably benign Het
Odf2 G T 2: 29,926,803 G754C probably benign Het
Olfr105-ps A G 17: 37,383,292 M242V probably benign Het
Olfr1270 A G 2: 90,149,178 I276T possibly damaging Het
Olfr270 A G 4: 52,971,419 Y266C possibly damaging Het
Olfr714 A T 7: 107,074,007 M60L probably damaging Het
Osbpl6 C T 2: 76,552,124 P222S probably benign Het
Pcdhga3 T C 18: 37,676,176 Y561H probably benign Het
Phykpl G A 11: 51,599,548 V419I probably benign Het
Pskh1 A G 8: 105,913,510 Y274C possibly damaging Het
Rap1gap G T 4: 137,717,431 V219F probably damaging Het
Rapgef4 C A 2: 72,174,868 H220N probably benign Het
Rcor3 G T 1: 192,125,881 H165Q possibly damaging Het
Reg3d T C 6: 78,377,439 T60A possibly damaging Het
Rgs9 T A 11: 109,225,723 D644V probably damaging Het
Rhob T A 12: 8,499,319 H105L probably benign Het
Rph3a T C 5: 120,963,829 K115E probably damaging Het
Rsf1 GG GGGGACGGCCG 7: 97,579,906 probably benign Het
Scn4b T A 9: 45,146,715 V35E probably damaging Het
Serpina3i T C 12: 104,265,413 I103T probably damaging Het
Sidt2 T C 9: 45,941,360 T776A possibly damaging Het
Slc15a5 A T 6: 137,984,458 V213E Het
Stard13 C A 5: 151,233,687 A10S probably benign Het
Taf6 C A 5: 138,180,959 V406F possibly damaging Het
Tap2 G T 17: 34,212,030 R368L possibly damaging Het
Tmem236 T C 2: 14,219,078 V226A probably benign Het
Tmem87a T A 2: 120,379,612 I287F possibly damaging Het
Ttll13 A T 7: 80,254,680 K351I possibly damaging Het
Ttn T A 2: 76,750,901 Y23216F probably damaging Het
Vmn2r27 T C 6: 124,224,285 T238A probably benign Het
Vmn2r54 T C 7: 12,632,128 Y293C possibly damaging Het
Vsig10l T C 7: 43,463,524 S69P Het
Wdr83 G A 8: 85,079,803 T122I probably damaging Het
Zfp219 A G 14: 52,008,743 V309A probably damaging Het
Zfp354a C T 11: 51,069,961 S332F probably damaging Het
Zfp354b T C 11: 50,923,060 N346S possibly damaging Het
Other mutations in Slc15a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01337:Slc15a1 APN 14 121460679 missense possibly damaging 0.95
IGL01534:Slc15a1 APN 14 121464952 missense possibly damaging 0.95
IGL01783:Slc15a1 APN 14 121471276 critical splice donor site probably null
IGL01799:Slc15a1 APN 14 121480729 missense possibly damaging 0.76
IGL02064:Slc15a1 APN 14 121462499 missense possibly damaging 0.66
IGL02064:Slc15a1 APN 14 121462474 missense probably benign 0.20
IGL02115:Slc15a1 APN 14 121480661 missense possibly damaging 0.61
IGL02514:Slc15a1 APN 14 121487040 missense probably damaging 1.00
IGL03056:Slc15a1 APN 14 121491283 missense possibly damaging 0.82
IGL03297:Slc15a1 APN 14 121486684 missense probably damaging 1.00
R1484:Slc15a1 UTSW 14 121491239 nonsense probably null
R1532:Slc15a1 UTSW 14 121475984 missense possibly damaging 0.79
R1655:Slc15a1 UTSW 14 121465899 missense probably benign 0.34
R2013:Slc15a1 UTSW 14 121475987 missense possibly damaging 0.88
R2270:Slc15a1 UTSW 14 121479994 missense probably damaging 0.99
R2878:Slc15a1 UTSW 14 121465933 missense probably benign 0.00
R2986:Slc15a1 UTSW 14 121489809 missense probably benign 0.02
R3862:Slc15a1 UTSW 14 121484857 missense probably benign 0.06
R3863:Slc15a1 UTSW 14 121484857 missense probably benign 0.06
R3978:Slc15a1 UTSW 14 121489827 missense probably benign 0.00
R4184:Slc15a1 UTSW 14 121466162 missense probably benign 0.00
R4573:Slc15a1 UTSW 14 121487029 missense probably damaging 0.99
R4604:Slc15a1 UTSW 14 121489907 missense probably damaging 1.00
R4649:Slc15a1 UTSW 14 121478092 missense probably damaging 1.00
R5838:Slc15a1 UTSW 14 121484871 missense probably damaging 1.00
R6221:Slc15a1 UTSW 14 121464904 missense probably null 1.00
R6891:Slc15a1 UTSW 14 121476030 missense probably benign 0.00
R7626:Slc15a1 UTSW 14 121475965 missense probably benign 0.13
R7836:Slc15a1 UTSW 14 121480733 nonsense probably null
R8284:Slc15a1 UTSW 14 121489863 missense probably benign 0.01
R8376:Slc15a1 UTSW 14 121480703 missense probably benign
R8408:Slc15a1 UTSW 14 121478116 missense possibly damaging 0.91
R8774:Slc15a1 UTSW 14 121487011 missense probably damaging 1.00
R8774-TAIL:Slc15a1 UTSW 14 121487011 missense probably damaging 1.00
R8933:Slc15a1 UTSW 14 121486679 missense probably benign 0.00
Z1088:Slc15a1 UTSW 14 121480054 missense probably benign 0.09
Z1088:Slc15a1 UTSW 14 121491044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCATGATGCTTAGAAGAAGAAGA -3'
(R):5'- CGTAGATCACCTGTTTAGCCT -3'

Sequencing Primer
(F):5'- CATGGGCTACGTACTAAGATCCTG -3'
(R):5'- CCTTAGAAGGTCAGCTCAGTG -3'
Posted On 2022-01-20