Mutagenetix > Incidental Mutations

Incidental Mutation 'R9157:Slc15a1'

695470

Institutional Source

Beutler Lab

Gene Symbol

Slc15a1

Ensembl Gene

ENSMUSG00000025557

Gene Name

solute carrier family 15 (oligopeptide transporter), member 1

Synonyms

PECT1, PEPT1

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R9157 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

121459621-121505252 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 121464977 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 586 (I586V)

Ref Sequence

ENSEMBL: ENSMUSP00000085728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088386]

AlphaFold

Q9JIP7

Predicted Effect

probably benign
Transcript: ENSMUST00000088386
AA Change: I586V

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000085728
Gene: ENSMUSG00000025557
AA Change: I586V

Domain	Start	End	E-Value	Type
Pfam:PTR2	81	477	1.9e-141	PFAM
Pfam:PTR2	562	644	4.2e-11	PFAM
transmembrane domain	650	672	N/A	INTRINSIC
low complexity region	684	695	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intestinal hydrogen peptide cotransporter that is a member of the solute carrier family 15. The encoded protein is localized to the brush border membrane of the intestinal epithelium and mediates the uptake of di- and tripeptides from the lumen into the enterocytes. This protein plays an important role in the uptake and digestion of dietary proteins. This protein also facilitates the absorption of numerous peptidomimetic drugs. [provided by RefSeq, Apr 2010]
PHENOTYPE: Peptide uptake in the intestine is substantially reduced in mice homozygous for a null mutation of this gene. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	T	C	3: 124,413,571	T324A	probably benign	Het
4930452B06Rik	T	A	14: 8,518,635	T274S	probably benign	Het
Adam9	A	T	8: 25,003,315	F92L	probably damaging	Het
Adgrb1	A	G	15: 74,539,775	T376A	probably damaging	Het
Aff3	A	C	1: 38,210,478	I516S	probably benign	Het
Bdp1	C	T	13: 100,049,928	S1672N	probably benign	Het
Btc	A	T	5: 91,366,121	I94N	probably damaging	Het
Ccdc47	A	T	11: 106,202,382		probably null	Het
Ceacam5	A	T	7: 17,759,494	Y814F	possibly damaging	Het
Celsr3	A	T	9: 108,829,986	R1223W	probably damaging	Het
Cenpc1	A	G	5: 86,018,457	M779T	probably benign	Het
Depdc5	T	C	5: 32,945,108	I986T	probably damaging	Het
Dhx40	A	T	11: 86,771,224	I669N	probably damaging	Het
Dnah1	T	A	14: 31,266,013	I3483F	probably damaging	Het
Dzip3	C	T	16: 48,927,761	G918D	probably benign	Het
Fam185a	T	G	5: 21,455,839	V284G	probably damaging	Het
Fhod3	T	C	18: 25,085,594	S805P	probably damaging	Het
Filip1l	A	G	16: 57,571,617	N856S	probably benign	Het
Gm12887	C	T	4: 121,616,504	V50M	probably benign	Het
Gm45785	T	C	7: 140,818,703	I94V	unknown	Het
Gm8251	A	G	1: 44,057,360	V1526A	probably benign	Het
Gm9195	A	G	14: 72,454,598	I1616T	unknown	Het
Grm4	T	A	17: 27,434,982	I665F	probably benign	Het
Hcls1	C	T	16: 36,956,638	A230V	probably benign	Het
Hic1	A	G	11: 75,166,227	L612P	possibly damaging	Het
Hmcn1	A	C	1: 150,646,592	V3519G	probably benign	Het
Hmgcs1	A	G	13: 119,704,427	Y360C	probably benign	Het
Hspa12a	A	T	19: 58,800,860	M448K	possibly damaging	Het
Htt	T	G	5: 34,829,827	I1130S	probably null	Het
Irx3	A	G	8: 91,801,066	Y59H	probably damaging	Het
Klc4	A	G	17: 46,639,435	L280P	probably damaging	Het
Lrp1	G	T	10: 127,574,340	N1512K	probably damaging	Het
Ltbp2	G	A	12: 84,791,090	P1192L	probably benign	Het
Marco	T	C	1: 120,494,085	E130G	probably damaging	Het
Mdga1	G	A	17: 29,838,517	T775M	probably damaging	Het
Ms4a18	A	T	19: 11,011,440	L184Q	probably damaging	Het
Msi2	A	C	11: 88,718,063	S10A	probably benign	Het
Muc5ac	T	C	7: 141,809,792	I2280T	unknown	Het
Ngfr	AAGCAGCAGCAGCAGCAGCAGCAG	AAGCAGCAGCAGCAGCAGCAG	11: 95,587,490		probably benign	Het
Nradd	A	G	9: 110,622,120	L60P	probably damaging	Het
Nup188	A	G	2: 30,298,444	Y39C	probably benign	Het
Odf2	G	T	2: 29,926,803	G754C	probably benign	Het
Olfr105-ps	A	G	17: 37,383,292	M242V	probably benign	Het
Olfr1270	A	G	2: 90,149,178	I276T	possibly damaging	Het
Olfr270	A	G	4: 52,971,419	Y266C	possibly damaging	Het
Olfr714	A	T	7: 107,074,007	M60L	probably damaging	Het
Osbpl6	C	T	2: 76,552,124	P222S	probably benign	Het
Pcdhga3	T	C	18: 37,676,176	Y561H	probably benign	Het
Phykpl	G	A	11: 51,599,548	V419I	probably benign	Het
Pskh1	A	G	8: 105,913,510	Y274C	possibly damaging	Het
Rap1gap	G	T	4: 137,717,431	V219F	probably damaging	Het
Rapgef4	C	A	2: 72,174,868	H220N	probably benign	Het
Rcor3	G	T	1: 192,125,881	H165Q	possibly damaging	Het
Reg3d	T	C	6: 78,377,439	T60A	possibly damaging	Het
Rgs9	T	A	11: 109,225,723	D644V	probably damaging	Het
Rhob	T	A	12: 8,499,319	H105L	probably benign	Het
Rph3a	T	C	5: 120,963,829	K115E	probably damaging	Het
Rsf1	GG	GGGGACGGCCG	7: 97,579,906		probably benign	Het
Scn4b	T	A	9: 45,146,715	V35E	probably damaging	Het
Serpina3i	T	C	12: 104,265,413	I103T	probably damaging	Het
Sidt2	T	C	9: 45,941,360	T776A	possibly damaging	Het
Slc15a5	A	T	6: 137,984,458	V213E		Het
Stard13	C	A	5: 151,233,687	A10S	probably benign	Het
Taf6	C	A	5: 138,180,959	V406F	possibly damaging	Het
Tap2	G	T	17: 34,212,030	R368L	possibly damaging	Het
Tmem236	T	C	2: 14,219,078	V226A	probably benign	Het
Tmem87a	T	A	2: 120,379,612	I287F	possibly damaging	Het
Ttll13	A	T	7: 80,254,680	K351I	possibly damaging	Het
Ttn	T	A	2: 76,750,901	Y23216F	probably damaging	Het
Vmn2r27	T	C	6: 124,224,285	T238A	probably benign	Het
Vmn2r54	T	C	7: 12,632,128	Y293C	possibly damaging	Het
Vsig10l	T	C	7: 43,463,524	S69P		Het
Wdr83	G	A	8: 85,079,803	T122I	probably damaging	Het
Zfp219	A	G	14: 52,008,743	V309A	probably damaging	Het
Zfp354a	C	T	11: 51,069,961	S332F	probably damaging	Het
Zfp354b	T	C	11: 50,923,060	N346S	possibly damaging	Het

Other mutations in Slc15a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01337:Slc15a1	APN	14	121460679	missense	possibly damaging	0.95
IGL01534:Slc15a1	APN	14	121464952	missense	possibly damaging	0.95
IGL01783:Slc15a1	APN	14	121471276	critical splice donor site	probably null
IGL01799:Slc15a1	APN	14	121480729	missense	possibly damaging	0.76
IGL02064:Slc15a1	APN	14	121462499	missense	possibly damaging	0.66
IGL02064:Slc15a1	APN	14	121462474	missense	probably benign	0.20
IGL02115:Slc15a1	APN	14	121480661	missense	possibly damaging	0.61
IGL02514:Slc15a1	APN	14	121487040	missense	probably damaging	1.00
IGL03056:Slc15a1	APN	14	121491283	missense	possibly damaging	0.82
IGL03297:Slc15a1	APN	14	121486684	missense	probably damaging	1.00
R1484:Slc15a1	UTSW	14	121491239	nonsense	probably null
R1532:Slc15a1	UTSW	14	121475984	missense	possibly damaging	0.79
R1655:Slc15a1	UTSW	14	121465899	missense	probably benign	0.34
R2013:Slc15a1	UTSW	14	121475987	missense	possibly damaging	0.88
R2270:Slc15a1	UTSW	14	121479994	missense	probably damaging	0.99
R2878:Slc15a1	UTSW	14	121465933	missense	probably benign	0.00
R2986:Slc15a1	UTSW	14	121489809	missense	probably benign	0.02
R3862:Slc15a1	UTSW	14	121484857	missense	probably benign	0.06
R3863:Slc15a1	UTSW	14	121484857	missense	probably benign	0.06
R3978:Slc15a1	UTSW	14	121489827	missense	probably benign	0.00
R4184:Slc15a1	UTSW	14	121466162	missense	probably benign	0.00
R4573:Slc15a1	UTSW	14	121487029	missense	probably damaging	0.99
R4604:Slc15a1	UTSW	14	121489907	missense	probably damaging	1.00
R4649:Slc15a1	UTSW	14	121478092	missense	probably damaging	1.00
R5838:Slc15a1	UTSW	14	121484871	missense	probably damaging	1.00
R6221:Slc15a1	UTSW	14	121464904	missense	probably null	1.00
R6891:Slc15a1	UTSW	14	121476030	missense	probably benign	0.00
R7626:Slc15a1	UTSW	14	121475965	missense	probably benign	0.13
R7836:Slc15a1	UTSW	14	121480733	nonsense	probably null
R8284:Slc15a1	UTSW	14	121489863	missense	probably benign	0.01
R8376:Slc15a1	UTSW	14	121480703	missense	probably benign
R8408:Slc15a1	UTSW	14	121478116	missense	possibly damaging	0.91
R8774:Slc15a1	UTSW	14	121487011	missense	probably damaging	1.00
R8774-TAIL:Slc15a1	UTSW	14	121487011	missense	probably damaging	1.00
R8933:Slc15a1	UTSW	14	121486679	missense	probably benign	0.00
Z1088:Slc15a1	UTSW	14	121480054	missense	probably benign	0.09
Z1088:Slc15a1	UTSW	14	121491044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCCATGATGCTTAGAAGAAGAAGA -3'
(R):5'- CGTAGATCACCTGTTTAGCCT -3'

Sequencing Primer
(F):5'- CATGGGCTACGTACTAAGATCCTG -3'
(R):5'- CCTTAGAAGGTCAGCTCAGTG -3'

Posted On

2022-01-20