Incidental Mutation 'R9158:Or13a25'
ID 695516
Institutional Source Beutler Lab
Gene Symbol Or13a25
Ensembl Gene ENSMUSG00000059136
Gene Name olfactory receptor family 13 subfamily A member 25
Synonyms GA_x6K02T2PBJ9-42813436-42814368, Olfr539, MOR253-4
MMRRC Submission 068942-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R9158 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 140247202-140248161 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 140247547 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 109 (S109P)
Ref Sequence ENSEMBL: ENSMUSP00000151522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078967] [ENSMUST00000218865]
AlphaFold Q8VGL9
Predicted Effect possibly damaging
Transcript: ENSMUST00000078967
AA Change: S116P

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077990
Gene: ENSMUSG00000059136
AA Change: S116P

DomainStartEndE-ValueType
Pfam:7tm_4 40 316 6.5e-50 PFAM
Pfam:7tm_1 50 299 4.9e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000218865
AA Change: S109P

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G A 8: 41,208,645 (GRCm39) C637Y probably damaging Het
Ahdc1 A G 4: 132,792,505 (GRCm39) T1249A possibly damaging Het
Alkbh3 A G 2: 93,835,082 (GRCm39) S88P probably damaging Het
Ankrd17 C A 5: 90,416,575 (GRCm39) A1086S probably damaging Het
Ankzf1 T A 1: 75,173,020 (GRCm39) V372E probably damaging Het
Apbb1ip T C 2: 22,764,951 (GRCm39) V544A probably benign Het
Atp13a2 T C 4: 140,724,112 (GRCm39) probably null Het
Cacna2d1 A G 5: 16,140,039 (GRCm39) T10A probably benign Het
Cadps T C 14: 12,546,356 (GRCm38) N500S probably benign Het
Casp16 A G 17: 23,769,948 (GRCm39) probably benign Het
Cdh22 T A 2: 165,012,627 (GRCm39) I153F probably damaging Het
Clip2 T C 5: 134,521,251 (GRCm39) E964G probably benign Het
Cracdl A T 1: 37,670,442 (GRCm39) M166K probably damaging Het
Cryga T C 1: 65,142,198 (GRCm39) D65G probably benign Het
Dap3 A G 3: 88,832,637 (GRCm39) Y357H probably damaging Het
Eef2 C T 10: 81,014,693 (GRCm39) probably benign Het
Gja4 A G 4: 127,206,466 (GRCm39) L99P probably damaging Het
Glb1l3 A T 9: 26,765,005 (GRCm39) Y135* probably null Het
Gm5114 T G 7: 39,060,486 (GRCm39) D121A probably damaging Het
Gm6525 A G 3: 84,082,255 (GRCm39) K59E probably benign Het
Herc1 C T 9: 66,376,400 (GRCm39) L3407F probably benign Het
Hmgcr G A 13: 96,792,170 (GRCm39) R589* probably null Het
Iglv3 A C 16: 19,060,012 (GRCm39) D105E probably damaging Het
Il1r1 G A 1: 40,332,391 (GRCm39) W60* probably null Het
Il31ra C T 13: 112,670,394 (GRCm39) W331* probably null Het
Inca1 C T 11: 70,581,376 (GRCm39) C16Y probably damaging Het
Inpp4a A G 1: 37,442,552 (GRCm39) T628A possibly damaging Het
Kdm2a C G 19: 4,374,715 (GRCm39) R805S possibly damaging Het
Kel T A 6: 41,664,905 (GRCm39) I620L probably benign Het
Kmt2d C T 15: 98,741,020 (GRCm39) G4638R unknown Het
Lilrb4b T A 10: 51,357,829 (GRCm39) N174K possibly damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Ltf T A 9: 110,868,003 (GRCm39) V615E probably damaging Het
Map7d1 G T 4: 126,130,478 (GRCm39) Q443K possibly damaging Het
Mapk9 A G 11: 49,745,095 (GRCm39) D3G probably benign Het
Nktr T G 9: 121,582,154 (GRCm39) S1424A unknown Het
Npas1 A G 7: 16,195,333 (GRCm39) S332P possibly damaging Het
Or52n2c T C 7: 104,574,086 (GRCm39) Y295C probably damaging Het
Or5ak4 A G 2: 85,161,348 (GRCm39) I298T probably benign Het
Or6d12 T C 6: 116,492,791 (GRCm39) F18L possibly damaging Het
Or8b12b C A 9: 37,684,800 (GRCm39) P282T probably damaging Het
Pcdh8 A G 14: 80,005,182 (GRCm39) W948R probably damaging Het
Pde3a A G 6: 141,195,614 (GRCm39) E100G probably benign Het
Phrf1 T A 7: 140,836,466 (GRCm39) V246D unknown Het
Pitpnb A T 5: 111,530,876 (GRCm39) N223I probably damaging Het
Pkd1l3 A T 8: 110,394,207 (GRCm39) R2065* probably null Het
Prepl T C 17: 85,383,379 (GRCm39) D355G possibly damaging Het
Runx2 A G 17: 45,046,508 (GRCm39) V5A probably benign Het
Sema4g T A 19: 44,986,846 (GRCm39) V433D possibly damaging Het
Sema6a C T 18: 47,431,330 (GRCm39) V123I probably damaging Het
Senp6 A G 9: 79,994,732 (GRCm39) K24E probably benign Het
Slc22a8 T A 19: 8,583,427 (GRCm39) S211T probably damaging Het
Slc34a2 A G 5: 53,221,217 (GRCm39) D221G possibly damaging Het
Tmprss11g A T 5: 86,637,166 (GRCm39) L323Q probably damaging Het
Tpcn1 T C 5: 120,687,988 (GRCm39) probably benign Het
Trim65 G A 11: 116,018,050 (GRCm39) T311I probably benign Het
Tub T C 7: 108,625,962 (GRCm39) F284L possibly damaging Het
Ube2j1 G A 4: 33,036,711 (GRCm39) V12I probably benign Het
Vmn2r101 A T 17: 19,809,161 (GRCm39) N97Y probably benign Het
Vmn2r49 C A 7: 9,722,835 (GRCm39) W146C probably damaging Het
Zfp628 T C 7: 4,922,153 (GRCm39) L125P probably damaging Het
Other mutations in Or13a25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Or13a25 APN 7 140,247,854 (GRCm39) missense probably benign 0.01
IGL01610:Or13a25 APN 7 140,247,584 (GRCm39) missense probably damaging 1.00
IGL02959:Or13a25 APN 7 140,247,463 (GRCm39) missense probably damaging 1.00
IGL03406:Or13a25 APN 7 140,247,424 (GRCm39) missense probably damaging 1.00
R0671:Or13a25 UTSW 7 140,247,590 (GRCm39) missense probably damaging 1.00
R1771:Or13a25 UTSW 7 140,248,048 (GRCm39) missense probably benign
R1934:Or13a25 UTSW 7 140,247,951 (GRCm39) nonsense probably null
R1985:Or13a25 UTSW 7 140,247,734 (GRCm39) missense probably damaging 1.00
R2962:Or13a25 UTSW 7 140,247,862 (GRCm39) missense probably benign
R4239:Or13a25 UTSW 7 140,247,496 (GRCm39) missense probably benign 0.07
R4240:Or13a25 UTSW 7 140,247,496 (GRCm39) missense probably benign 0.07
R4360:Or13a25 UTSW 7 140,247,730 (GRCm39) missense probably damaging 0.98
R4841:Or13a25 UTSW 7 140,247,502 (GRCm39) missense probably damaging 1.00
R4842:Or13a25 UTSW 7 140,247,502 (GRCm39) missense probably damaging 1.00
R4851:Or13a25 UTSW 7 140,247,226 (GRCm39) missense probably benign
R5325:Or13a25 UTSW 7 140,247,705 (GRCm39) missense probably benign 0.33
R5766:Or13a25 UTSW 7 140,247,266 (GRCm39) missense probably benign 0.02
R6363:Or13a25 UTSW 7 140,247,995 (GRCm39) missense possibly damaging 0.93
R6836:Or13a25 UTSW 7 140,248,093 (GRCm39) missense possibly damaging 0.86
R7777:Or13a25 UTSW 7 140,247,854 (GRCm39) missense probably benign 0.01
R7920:Or13a25 UTSW 7 140,247,814 (GRCm39) missense possibly damaging 0.92
R8134:Or13a25 UTSW 7 140,247,680 (GRCm39) missense possibly damaging 0.90
R8712:Or13a25 UTSW 7 140,248,052 (GRCm39) missense possibly damaging 0.89
R9095:Or13a25 UTSW 7 140,247,813 (GRCm39) missense probably damaging 1.00
R9603:Or13a25 UTSW 7 140,247,794 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGTCACCTTCAGCACAGG -3'
(R):5'- TCTCACAGAAGAAGTGGGTGATAAC -3'

Sequencing Primer
(F):5'- GGGCTTCACAATCCCATGTAC -3'
(R):5'- TGGGTGATAACCTTGGGACCAC -3'
Posted On 2022-01-20