Incidental Mutation 'R9158:Olfr539'
ID 695516
Institutional Source Beutler Lab
Gene Symbol Olfr539
Ensembl Gene ENSMUSG00000059136
Gene Name olfactory receptor 539
Synonyms MOR253-4, GA_x6K02T2PBJ9-42813436-42814368
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R9158 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 140659930-140678580 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 140667634 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 109 (S109P)
Ref Sequence ENSEMBL: ENSMUSP00000151522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078967] [ENSMUST00000218865]
AlphaFold Q8VGL9
Predicted Effect possibly damaging
Transcript: ENSMUST00000078967
AA Change: S116P

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077990
Gene: ENSMUSG00000059136
AA Change: S116P

DomainStartEndE-ValueType
Pfam:7tm_4 40 316 6.5e-50 PFAM
Pfam:7tm_1 50 299 4.9e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000218865
AA Change: S109P

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,631,361 M166K probably damaging Het
Adam25 G A 8: 40,755,608 C637Y probably damaging Het
Ahdc1 A G 4: 133,065,194 T1249A possibly damaging Het
Alkbh3 A G 2: 94,004,737 S88P probably damaging Het
Ankrd17 C A 5: 90,268,716 A1086S probably damaging Het
Ankzf1 T A 1: 75,196,376 V372E probably damaging Het
Apbb1ip T C 2: 22,874,939 V544A probably benign Het
Atp13a2 T C 4: 140,996,801 probably null Het
Cacna2d1 A G 5: 15,935,041 T10A probably benign Het
Cadps T C 14: 12,546,356 N500S probably benign Het
Casp16-ps A G 17: 23,550,974 probably benign Het
Cdh22 T A 2: 165,170,707 I153F probably damaging Het
Clip2 T C 5: 134,492,397 E964G probably benign Het
Cryga T C 1: 65,103,039 D65G probably benign Het
Dap3 A G 3: 88,925,330 Y357H probably damaging Het
Eef2 C T 10: 81,178,859 probably benign Het
Gja4 A G 4: 127,312,673 L99P probably damaging Het
Glb1l3 A T 9: 26,853,709 Y135* probably null Het
Gm5114 T G 7: 39,411,062 D121A probably damaging Het
Gm6525 A G 3: 84,174,948 K59E probably benign Het
Herc1 C T 9: 66,469,118 L3407F probably benign Het
Hmgcr G A 13: 96,655,662 R589* probably null Het
Iglv3 A C 16: 19,241,262 D105E probably damaging Het
Il1r1 G A 1: 40,293,231 W60* probably null Het
Il31ra C T 13: 112,533,860 W331* probably null Het
Inca1 C T 11: 70,690,550 C16Y probably damaging Het
Inpp4a A G 1: 37,403,471 T628A possibly damaging Het
Kdm2a C G 19: 4,324,687 R805S possibly damaging Het
Kel T A 6: 41,687,971 I620L probably benign Het
Kmt2d C T 15: 98,843,139 G4638R unknown Het
Lilr4b T A 10: 51,481,733 N174K possibly damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Ltf T A 9: 111,038,935 V615E probably damaging Het
Map7d1 G T 4: 126,236,685 Q443K possibly damaging Het
Mapk9 A G 11: 49,854,268 D3G probably benign Het
Nktr T G 9: 121,753,088 S1424A unknown Het
Npas1 A G 7: 16,461,408 S332P possibly damaging Het
Olfr212 T C 6: 116,515,830 F18L possibly damaging Het
Olfr668 T C 7: 104,924,879 Y295C probably damaging Het
Olfr875 C A 9: 37,773,504 P282T probably damaging Het
Olfr987 A G 2: 85,331,004 I298T probably benign Het
Pcdh8 A G 14: 79,767,742 W948R probably damaging Het
Pde3a A G 6: 141,249,888 E100G probably benign Het
Phrf1 T A 7: 141,256,553 V246D unknown Het
Pitpnb A T 5: 111,383,010 N223I probably damaging Het
Pkd1l3 A T 8: 109,667,575 R2065* probably null Het
Prepl T C 17: 85,075,951 D355G possibly damaging Het
Runx2 A G 17: 44,735,621 V5A probably benign Het
Sema4g T A 19: 44,998,407 V433D possibly damaging Het
Sema6a C T 18: 47,298,263 V123I probably damaging Het
Senp6 A G 9: 80,087,450 K24E probably benign Het
Slc22a8 T A 19: 8,606,063 S211T probably damaging Het
Slc34a2 A G 5: 53,063,875 D221G possibly damaging Het
Tmprss11g A T 5: 86,489,307 L323Q probably damaging Het
Tpcn1 T C 5: 120,549,923 probably benign Het
Trim65 G A 11: 116,127,224 T311I probably benign Het
Tub T C 7: 109,026,755 F284L possibly damaging Het
Ube2j1 G A 4: 33,036,711 V12I probably benign Het
Vmn2r101 A T 17: 19,588,899 N97Y probably benign Het
Vmn2r49 C A 7: 9,988,908 W146C probably damaging Het
Zfp628 T C 7: 4,919,154 L125P probably damaging Het
Other mutations in Olfr539
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Olfr539 APN 7 140667941 missense probably benign 0.01
IGL01610:Olfr539 APN 7 140667671 missense probably damaging 1.00
IGL02959:Olfr539 APN 7 140667550 missense probably damaging 1.00
IGL03406:Olfr539 APN 7 140667511 missense probably damaging 1.00
R0671:Olfr539 UTSW 7 140667677 missense probably damaging 1.00
R1771:Olfr539 UTSW 7 140668135 missense probably benign
R1934:Olfr539 UTSW 7 140668038 nonsense probably null
R1985:Olfr539 UTSW 7 140667821 missense probably damaging 1.00
R2962:Olfr539 UTSW 7 140667949 missense probably benign
R4239:Olfr539 UTSW 7 140667583 missense probably benign 0.07
R4240:Olfr539 UTSW 7 140667583 missense probably benign 0.07
R4360:Olfr539 UTSW 7 140667817 missense probably damaging 0.98
R4841:Olfr539 UTSW 7 140667589 missense probably damaging 1.00
R4842:Olfr539 UTSW 7 140667589 missense probably damaging 1.00
R4851:Olfr539 UTSW 7 140667313 missense probably benign
R5325:Olfr539 UTSW 7 140667792 missense probably benign 0.33
R5766:Olfr539 UTSW 7 140667353 missense probably benign 0.02
R6363:Olfr539 UTSW 7 140668082 missense possibly damaging 0.93
R6836:Olfr539 UTSW 7 140668180 missense possibly damaging 0.86
R7777:Olfr539 UTSW 7 140667941 missense probably benign 0.01
R7920:Olfr539 UTSW 7 140667901 missense possibly damaging 0.92
R8134:Olfr539 UTSW 7 140667767 missense possibly damaging 0.90
R8712:Olfr539 UTSW 7 140668139 missense possibly damaging 0.89
R9095:Olfr539 UTSW 7 140667900 missense probably damaging 1.00
R9603:Olfr539 UTSW 7 140667881 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGTCACCTTCAGCACAGG -3'
(R):5'- TCTCACAGAAGAAGTGGGTGATAAC -3'

Sequencing Primer
(F):5'- GGGCTTCACAATCCCATGTAC -3'
(R):5'- TGGGTGATAACCTTGGGACCAC -3'
Posted On 2022-01-20