Incidental Mutation 'R9159:Nphs1'
ID 695575
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Name nephrosis 1, nephrin
Synonyms nephrin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9159 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 30458315-30487223 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 30465601 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 540 (F540V)
Ref Sequence ENSEMBL: ENSMUSP00000006825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
AlphaFold Q9QZS7
Predicted Effect possibly damaging
Transcript: ENSMUST00000006825
AA Change: F540V

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: F540V

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000126297
AA Change: F526V

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: F526V

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,282,690 R4829* probably null Het
9930012K11Rik A T 14: 70,156,789 M179K probably benign Het
A030003K21Rik A G 1: 82,943,066 V86A unknown Het
AC133488.1 A T 16: 18,621,325 V363E probably benign Het
Adamts16 A G 13: 70,753,289 S890P probably benign Het
Adgrf4 A G 17: 42,662,402 V685A probably benign Het
Aff1 T A 5: 103,842,265 M867K possibly damaging Het
Apba3 T A 10: 81,271,033 S225T Het
Aplp1 T A 7: 30,442,350 T228S probably benign Het
Arhgap18 A G 10: 26,854,890 D188G probably benign Het
BC024063 T A 10: 82,109,072 S175R possibly damaging Het
BC055324 A G 1: 163,986,945 I143T probably damaging Het
Bloc1s6 T G 2: 122,738,628 S2R probably damaging Het
Cd209b A G 8: 3,924,245 I119T possibly damaging Het
Cdk8 T C 5: 146,231,739 V16A probably damaging Het
Cep295 A G 9: 15,341,608 M308T probably benign Het
Cfap53 T A 18: 74,283,201 Y2N probably damaging Het
Col28a1 T A 6: 8,014,993 D804V probably damaging Het
Cyp2c40 A T 19: 39,773,873 D443E probably damaging Het
Cyp2d9 A G 15: 82,454,371 D202G possibly damaging Het
D3Ertd254e C A 3: 36,165,753 H642N possibly damaging Het
Dchs1 G A 7: 105,765,919 A686V probably benign Het
Egf A T 3: 129,678,377 N1199K probably benign Het
Eva1a A G 6: 82,091,874 R61G possibly damaging Het
Exoc6 T A 19: 37,609,030 D626E probably benign Het
Exosc10 T C 4: 148,579,459 probably null Het
Gm12888 T C 4: 121,319,403 Q67R probably null Het
Gm16485 A G 9: 8,972,318 S62G unknown Het
Gm5416 G A 16: 36,217,699 V69I probably benign Het
Gng4 T C 13: 13,825,311 I55T probably damaging Het
Gpihbp1 A G 15: 75,597,981 S182G possibly damaging Het
Hax1 T C 3: 89,995,820 R251G probably damaging Het
Igf2bp2 G A 16: 22,081,752 T213I probably damaging Het
Il23a T A 10: 128,297,558 K66* probably null Het
Itga2 A T 13: 114,877,762 L210* probably null Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Matr3 T A 18: 35,579,302 M389K possibly damaging Het
Mettl15 T C 2: 109,093,099 D326G probably damaging Het
Mta1 T A 12: 113,136,405 V645E probably damaging Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Naa15 T A 3: 51,451,381 N362K probably benign Het
Necab2 T C 8: 119,462,564 Y158H probably damaging Het
Nphp3 T A 9: 104,020,781 L523Q probably damaging Het
Olfr267 A G 4: 58,785,320 I134T probably benign Het
Olfr332 A G 11: 58,490,524 V77A probably damaging Het
Olfr476 A T 7: 107,968,317 R307* probably null Het
Ppa1 A T 10: 61,661,005 I91F probably damaging Het
Prdm6 C A 18: 53,464,947 A127D unknown Het
Prdm8 T C 5: 98,186,316 F581L probably damaging Het
Rbbp6 T C 7: 122,990,205 I372T probably damaging Het
Rnf144b A G 13: 47,242,872 I228M probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Setd2 T C 9: 110,545,317 probably null Het
Sez6l T C 5: 112,465,958 H441R possibly damaging Het
Shbg G A 11: 69,615,604 L327F probably benign Het
Sik3 C T 9: 46,212,241 Q1113* probably null Het
Smad2 T A 18: 76,262,502 I4N possibly damaging Het
Sult2b1 T A 7: 45,742,110 E84V probably damaging Het
Tbc1d8 A G 1: 39,405,393 Y162H Het
Tedc2 A G 17: 24,217,731 L308P probably damaging Het
Tmc5 T C 7: 118,634,041 V26A probably benign Het
Tmem120b T A 5: 123,104,503 N181K possibly damaging Het
Tmem229b T G 12: 78,964,674 N161T possibly damaging Het
Tmem43 A C 6: 91,482,309 D254A probably benign Het
Trpv6 T C 6: 41,626,140 D266G probably benign Het
Tspan9 A G 6: 127,966,754 I102T possibly damaging Het
Ung A G 5: 114,132,105 probably benign Het
Upp2 C T 2: 58,777,984 H230Y probably damaging Het
Vmn1r184 G A 7: 26,267,120 S97N possibly damaging Het
Vmn2r73 A T 7: 85,872,723 V136E possibly damaging Het
Wdr20rt T C 12: 65,226,144 V127A probably damaging Het
Yme1l1 T A 2: 23,173,046 F210I probably damaging Het
Yrdc T C 4: 124,854,018 probably null Het
Zfhx4 G T 3: 5,399,252 R1515L probably damaging Het
Zfhx4 C T 3: 5,401,157 P2150L probably damaging Het
Zfp988 C T 4: 147,331,993 P295S possibly damaging Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30482551 missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30460739 unclassified probably benign
IGL00976:Nphs1 APN 7 30460685 missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30486664 missense probably benign 0.01
IGL01465:Nphs1 APN 7 30486714 makesense probably null
IGL01889:Nphs1 APN 7 30460511 missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30481635 splice site probably benign
R0020:Nphs1 UTSW 7 30463208 missense probably benign 0.01
R0485:Nphs1 UTSW 7 30467515 missense probably benign
R1024:Nphs1 UTSW 7 30474277 missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30481378 splice site probably benign
R1144:Nphs1 UTSW 7 30481678 splice site probably benign
R1289:Nphs1 UTSW 7 30471178 missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30481831 splice site probably benign
R1617:Nphs1 UTSW 7 30482531 missense probably benign
R1756:Nphs1 UTSW 7 30461534 missense probably benign 0.00
R1937:Nphs1 UTSW 7 30474373 missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30460970 missense probably benign 0.13
R2256:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30467564 nonsense probably null
R3104:Nphs1 UTSW 7 30467540 nonsense probably null
R3106:Nphs1 UTSW 7 30467540 nonsense probably null
R3151:Nphs1 UTSW 7 30460240 missense probably benign
R3765:Nphs1 UTSW 7 30471210 missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30467520 nonsense probably null
R4397:Nphs1 UTSW 7 30481965 splice site probably null
R4635:Nphs1 UTSW 7 30468007 missense probably benign 0.39
R4650:Nphs1 UTSW 7 30482470 missense probably benign 0.21
R4811:Nphs1 UTSW 7 30460429 missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30463232 missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30481642 missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30463825 missense probably benign 0.00
R5681:Nphs1 UTSW 7 30486625 missense probably benign 0.00
R5865:Nphs1 UTSW 7 30474385 missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30466115 missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30465634 missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30467915 missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30474544 missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30462828 missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30481965 splice site probably null
R7767:Nphs1 UTSW 7 30463308 missense probably damaging 1.00
R8132:Nphs1 UTSW 7 30482053 missense probably benign 0.02
R8485:Nphs1 UTSW 7 30466173 missense probably damaging 0.98
R8678:Nphs1 UTSW 7 30463859 missense probably damaging 1.00
R8890:Nphs1 UTSW 7 30462655 missense probably damaging 1.00
R8946:Nphs1 UTSW 7 30463200 missense probably damaging 1.00
R9133:Nphs1 UTSW 7 30460667 nonsense probably null
R9347:Nphs1 UTSW 7 30471169 missense probably damaging 1.00
R9547:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9548:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9607:Nphs1 UTSW 7 30463587 missense probably damaging 1.00
R9626:Nphs1 UTSW 7 30467566 missense probably benign 0.16
R9720:Nphs1 UTSW 7 30466074 missense possibly damaging 0.83
R9733:Nphs1 UTSW 7 30467530 missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30467504 missense probably null 0.01
Z1177:Nphs1 UTSW 7 30470903 missense probably damaging 1.00
Z1186:Nphs1 UTSW 7 30460350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACACAAAGGCCCTCTCTG -3'
(R):5'- AGGTCAAGTTCAAGGCGTC -3'

Sequencing Primer
(F):5'- CCTCTCTGGGCTAACGGC -3'
(R):5'- ACGAGTTGGCCAGGATGGTC -3'
Posted On 2022-01-20