Incidental Mutation 'R9159:Nphp3'
ID 695589
Institutional Source Beutler Lab
Gene Symbol Nphp3
Ensembl Gene ENSMUSG00000032558
Gene Name nephronophthisis 3 (adolescent)
Synonyms 3632410F03Rik, D330020E01Rik, pcy, nephrocystin 3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9159 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 104002544-104043818 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 104020781 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 523 (L523Q)
Ref Sequence ENSEMBL: ENSMUSP00000035167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035167] [ENSMUST00000193439] [ENSMUST00000194774]
AlphaFold Q7TNH6
Predicted Effect probably damaging
Transcript: ENSMUST00000035167
AA Change: L523Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035167
Gene: ENSMUSG00000032558
AA Change: L523Q

DomainStartEndE-ValueType
low complexity region 46 69 N/A INTRINSIC
coiled coil region 107 203 N/A INTRINSIC
low complexity region 512 537 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 640 650 N/A INTRINSIC
TPR 938 971 3.16e1 SMART
TPR 980 1013 7.74e-2 SMART
TPR 1022 1055 3.24e1 SMART
low complexity region 1066 1080 N/A INTRINSIC
TPR 1088 1121 3.67e-3 SMART
TPR 1130 1163 1.3e-3 SMART
TPR 1172 1205 4.38e-1 SMART
TPR 1214 1247 8.69e-5 SMART
TPR 1256 1289 9.03e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193439
AA Change: L429Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141540
Gene: ENSMUSG00000032558
AA Change: L429Q

DomainStartEndE-ValueType
coiled coil region 75 109 N/A INTRINSIC
low complexity region 418 443 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000141596
Gene: ENSMUSG00000032558
AA Change: L403Q

DomainStartEndE-ValueType
coiled coil region 49 83 N/A INTRINSIC
Pfam:NACHT 400 559 2e-6 PFAM
TPR 818 851 3.16e1 SMART
TPR 860 893 7.74e-2 SMART
TPR 902 935 3.24e1 SMART
low complexity region 946 960 N/A INTRINSIC
TPR 968 1001 3.67e-3 SMART
TPR 1010 1043 1.3e-3 SMART
TPR 1052 1085 4.38e-1 SMART
TPR 1094 1127 8.69e-5 SMART
TPR 1136 1169 9.03e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a coiled-coil (CC) domain, a tubulin-tyrosine ligase (TTL) domain, and a tetratrico peptide repeat (TPR) domain. The encoded protein interacts with nephrocystin, it is required for normal ciliary development, and it functions in renal tubular development. Mutations in this gene are associated with nephronophthisis type 3, and also with renal-hepatic-pancreatic dysplasia, and Meckel syndrome type 7. Naturally occurring read-through transcripts exist between this gene and the downstream ACAD11 (acyl-CoA dehydrogenase family, member 11) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice display slowly progressing kidney cysts, enlarged kidneys, increased blood urea nitrogen, kidney inflammation and associated fibrosis, and premature death. Homozygous null mice display mid gestational lethality with partial penetrance of situs inversus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,282,690 R4829* probably null Het
9930012K11Rik A T 14: 70,156,789 M179K probably benign Het
A030003K21Rik A G 1: 82,943,066 V86A unknown Het
AC133488.1 A T 16: 18,621,325 V363E probably benign Het
Adamts16 A G 13: 70,753,289 S890P probably benign Het
Adgrf4 A G 17: 42,662,402 V685A probably benign Het
Aff1 T A 5: 103,842,265 M867K possibly damaging Het
Apba3 T A 10: 81,271,033 S225T Het
Aplp1 T A 7: 30,442,350 T228S probably benign Het
Arhgap18 A G 10: 26,854,890 D188G probably benign Het
BC024063 T A 10: 82,109,072 S175R possibly damaging Het
BC055324 A G 1: 163,986,945 I143T probably damaging Het
Bloc1s6 T G 2: 122,738,628 S2R probably damaging Het
Cd209b A G 8: 3,924,245 I119T possibly damaging Het
Cdk8 T C 5: 146,231,739 V16A probably damaging Het
Cep295 A G 9: 15,341,608 M308T probably benign Het
Cfap53 T A 18: 74,283,201 Y2N probably damaging Het
Col28a1 T A 6: 8,014,993 D804V probably damaging Het
Cyp2c40 A T 19: 39,773,873 D443E probably damaging Het
Cyp2d9 A G 15: 82,454,371 D202G possibly damaging Het
D3Ertd254e C A 3: 36,165,753 H642N possibly damaging Het
Dchs1 G A 7: 105,765,919 A686V probably benign Het
Egf A T 3: 129,678,377 N1199K probably benign Het
Eva1a A G 6: 82,091,874 R61G possibly damaging Het
Exoc6 T A 19: 37,609,030 D626E probably benign Het
Exosc10 T C 4: 148,579,459 probably null Het
Gm12888 T C 4: 121,319,403 Q67R probably null Het
Gm16485 A G 9: 8,972,318 S62G unknown Het
Gm5416 G A 16: 36,217,699 V69I probably benign Het
Gng4 T C 13: 13,825,311 I55T probably damaging Het
Gpihbp1 A G 15: 75,597,981 S182G possibly damaging Het
Hax1 T C 3: 89,995,820 R251G probably damaging Het
Igf2bp2 G A 16: 22,081,752 T213I probably damaging Het
Il23a T A 10: 128,297,558 K66* probably null Het
Itga2 A T 13: 114,877,762 L210* probably null Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Matr3 T A 18: 35,579,302 M389K possibly damaging Het
Mettl15 T C 2: 109,093,099 D326G probably damaging Het
Mta1 T A 12: 113,136,405 V645E probably damaging Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Naa15 T A 3: 51,451,381 N362K probably benign Het
Necab2 T C 8: 119,462,564 Y158H probably damaging Het
Nphs1 T G 7: 30,465,601 F540V possibly damaging Het
Olfr267 A G 4: 58,785,320 I134T probably benign Het
Olfr332 A G 11: 58,490,524 V77A probably damaging Het
Olfr476 A T 7: 107,968,317 R307* probably null Het
Ppa1 A T 10: 61,661,005 I91F probably damaging Het
Prdm6 C A 18: 53,464,947 A127D unknown Het
Prdm8 T C 5: 98,186,316 F581L probably damaging Het
Rbbp6 T C 7: 122,990,205 I372T probably damaging Het
Rnf144b A G 13: 47,242,872 I228M probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Setd2 T C 9: 110,545,317 probably null Het
Sez6l T C 5: 112,465,958 H441R possibly damaging Het
Shbg G A 11: 69,615,604 L327F probably benign Het
Sik3 C T 9: 46,212,241 Q1113* probably null Het
Smad2 T A 18: 76,262,502 I4N possibly damaging Het
Sult2b1 T A 7: 45,742,110 E84V probably damaging Het
Tbc1d8 A G 1: 39,405,393 Y162H Het
Tedc2 A G 17: 24,217,731 L308P probably damaging Het
Tmc5 T C 7: 118,634,041 V26A probably benign Het
Tmem120b T A 5: 123,104,503 N181K possibly damaging Het
Tmem229b T G 12: 78,964,674 N161T possibly damaging Het
Tmem43 A C 6: 91,482,309 D254A probably benign Het
Trpv6 T C 6: 41,626,140 D266G probably benign Het
Tspan9 A G 6: 127,966,754 I102T possibly damaging Het
Ung A G 5: 114,132,105 probably benign Het
Upp2 C T 2: 58,777,984 H230Y probably damaging Het
Vmn1r184 G A 7: 26,267,120 S97N possibly damaging Het
Vmn2r73 A T 7: 85,872,723 V136E possibly damaging Het
Wdr20rt T C 12: 65,226,144 V127A probably damaging Het
Yme1l1 T A 2: 23,173,046 F210I probably damaging Het
Yrdc T C 4: 124,854,018 probably null Het
Zfhx4 G T 3: 5,399,252 R1515L probably damaging Het
Zfhx4 C T 3: 5,401,157 P2150L probably damaging Het
Zfp988 C T 4: 147,331,993 P295S possibly damaging Het
Other mutations in Nphp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Nphp3 APN 9 104018158 missense possibly damaging 0.75
IGL02329:Nphp3 APN 9 104025968 missense probably benign 0.19
lithograph UTSW 9 104041990 missense probably damaging 1.00
F5770:Nphp3 UTSW 9 104035894 critical splice donor site probably null
FR4548:Nphp3 UTSW 9 104025939 small deletion probably benign
FR4589:Nphp3 UTSW 9 104025939 small deletion probably benign
R0112:Nphp3 UTSW 9 104037348 missense possibly damaging 0.80
R0555:Nphp3 UTSW 9 104023434 missense probably damaging 1.00
R0632:Nphp3 UTSW 9 104018274 missense probably damaging 1.00
R0674:Nphp3 UTSW 9 104036282 critical splice donor site probably null
R0743:Nphp3 UTSW 9 104022768 small deletion probably benign
R0853:Nphp3 UTSW 9 104031933 missense probably benign 0.03
R0920:Nphp3 UTSW 9 104031907 missense probably benign 0.00
R1420:Nphp3 UTSW 9 104035893 critical splice donor site probably null
R1464:Nphp3 UTSW 9 104031879 splice site probably benign
R1476:Nphp3 UTSW 9 104025927 missense possibly damaging 0.81
R1585:Nphp3 UTSW 9 104009214 missense probably damaging 1.00
R1608:Nphp3 UTSW 9 104035840 missense probably benign 0.30
R1688:Nphp3 UTSW 9 104003124 missense probably damaging 1.00
R1691:Nphp3 UTSW 9 104002811 missense probably benign
R1807:Nphp3 UTSW 9 104020741 missense probably benign 0.01
R1857:Nphp3 UTSW 9 104021294 missense possibly damaging 0.87
R1962:Nphp3 UTSW 9 104021338 missense probably benign 0.00
R2127:Nphp3 UTSW 9 104008243 missense probably damaging 0.98
R2138:Nphp3 UTSW 9 104025903 missense possibly damaging 0.89
R2233:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R2234:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R3861:Nphp3 UTSW 9 104039326 unclassified probably benign
R3928:Nphp3 UTSW 9 104011730 missense probably damaging 0.99
R3961:Nphp3 UTSW 9 104003042 nonsense probably null
R4182:Nphp3 UTSW 9 104038464 missense probably benign 0.06
R4294:Nphp3 UTSW 9 104022717 missense probably damaging 1.00
R4387:Nphp3 UTSW 9 104030020 missense possibly damaging 0.94
R4625:Nphp3 UTSW 9 104036159 missense possibly damaging 0.66
R4628:Nphp3 UTSW 9 104003058 missense probably damaging 0.99
R4696:Nphp3 UTSW 9 104022732 missense probably benign 0.01
R4865:Nphp3 UTSW 9 104031970 missense probably benign
R4886:Nphp3 UTSW 9 104002994 missense probably damaging 1.00
R4973:Nphp3 UTSW 9 104031999 missense probably benign
R5445:Nphp3 UTSW 9 104004723 missense probably damaging 1.00
R5451:Nphp3 UTSW 9 104042022 missense probably benign
R5520:Nphp3 UTSW 9 104024673 missense probably benign 0.30
R5641:Nphp3 UTSW 9 104036153 missense probably damaging 1.00
R5847:Nphp3 UTSW 9 104003037 missense probably damaging 1.00
R5928:Nphp3 UTSW 9 104035797 missense probably benign 0.01
R5931:Nphp3 UTSW 9 104020746 missense probably damaging 1.00
R6161:Nphp3 UTSW 9 104031906 missense probably benign 0.11
R6298:Nphp3 UTSW 9 104015441 missense probably damaging 1.00
R6890:Nphp3 UTSW 9 104041954 missense probably damaging 0.96
R7009:Nphp3 UTSW 9 104016116 missense probably null 0.00
R7065:Nphp3 UTSW 9 104041990 missense probably damaging 1.00
R7146:Nphp3 UTSW 9 104004837 nonsense probably null
R7198:Nphp3 UTSW 9 104004775 missense probably damaging 1.00
R7360:Nphp3 UTSW 9 104016078 critical splice acceptor site probably null
R7369:Nphp3 UTSW 9 104018250 missense probably damaging 0.99
R7554:Nphp3 UTSW 9 104042071 missense probably damaging 0.98
R7591:Nphp3 UTSW 9 104018278 critical splice donor site probably null
R7665:Nphp3 UTSW 9 104005393 splice site probably null
R7672:Nphp3 UTSW 9 104031960 missense probably benign
R7675:Nphp3 UTSW 9 104016088 missense probably benign
R8039:Nphp3 UTSW 9 104031963 missense probably benign
R8145:Nphp3 UTSW 9 104035851 missense probably benign 0.16
R8211:Nphp3 UTSW 9 104031897 missense possibly damaging 0.80
R8882:Nphp3 UTSW 9 104005594 missense possibly damaging 0.77
R9020:Nphp3 UTSW 9 104031951 missense probably benign 0.00
R9132:Nphp3 UTSW 9 104020781 missense probably damaging 1.00
R9135:Nphp3 UTSW 9 104032015 missense probably damaging 0.99
R9204:Nphp3 UTSW 9 104042106 missense probably benign
R9226:Nphp3 UTSW 9 104008129 missense probably benign 0.00
R9229:Nphp3 UTSW 9 104036177 missense probably damaging 1.00
V7583:Nphp3 UTSW 9 104035894 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGCTCCAGTGTACAGATCAG -3'
(R):5'- ACATTCAACTAAGAGCATGCAG -3'

Sequencing Primer
(F):5'- CGGCCAGATGCAAGTTTTTC -3'
(R):5'- GGTCATCTTTAGTTACACAGCGAG -3'
Posted On 2022-01-20