Incidental Mutation 'R9159:Mta1'
ID 695602
Institutional Source Beutler Lab
Gene Symbol Mta1
Ensembl Gene ENSMUSG00000021144
Gene Name metastasis associated 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9159 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 113098278-113137206 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 113136405 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 645 (V645E)
Ref Sequence ENSEMBL: ENSMUSP00000105349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009099] [ENSMUST00000069690] [ENSMUST00000084882] [ENSMUST00000109723] [ENSMUST00000109726] [ENSMUST00000109727] [ENSMUST00000200380]
AlphaFold Q8K4B0
Predicted Effect probably damaging
Transcript: ENSMUST00000009099
AA Change: V657E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000009099
Gene: ENSMUSG00000021144
AA Change: V657E

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000069690
AA Change: V640E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000064338
Gene: ENSMUSG00000021144
AA Change: V640E

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084882
SMART Domains Protein: ENSMUSP00000081943
Gene: ENSMUSG00000006356

DomainStartEndE-ValueType
LIM 4 56 2.08e-12 SMART
low complexity region 104 115 N/A INTRINSIC
LIM 125 177 6.05e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109723
AA Change: V645E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105345
Gene: ENSMUSG00000021144
AA Change: V645E

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109726
AA Change: V640E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105348
Gene: ENSMUSG00000021144
AA Change: V640E

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109727
AA Change: V645E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105349
Gene: ENSMUSG00000021144
AA Change: V645E

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200380
SMART Domains Protein: ENSMUSP00000143334
Gene: ENSMUSG00000006356

DomainStartEndE-ValueType
LIM 1 53 3e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified in a screen for genes expressed in metastatic cells, specifically, mammary adenocarcinoma cell lines. Expression of this gene has been correlated with the metastatic potential of at least two types of carcinomas although it is also expressed in many normal tissues. The role it plays in metastasis is unclear. It was initially thought to be the 70kD component of a nucleosome remodeling deacetylase complex, NuRD, but it is more likely that this component is a different but very similar protein. These two proteins are so closely related, though, that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. The profile and activity of this gene product suggest that it is involved in regulating transcription and that this may be accomplished by chromatin remodeling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cellular sensitivity to ionizing radiation and increased retinal cell proliferation at E14.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik G A 10: 82,282,690 R4829* probably null Het
9930012K11Rik A T 14: 70,156,789 M179K probably benign Het
A030003K21Rik A G 1: 82,943,066 V86A unknown Het
AC133488.1 A T 16: 18,621,325 V363E probably benign Het
Adamts16 A G 13: 70,753,289 S890P probably benign Het
Adgrf4 A G 17: 42,662,402 V685A probably benign Het
Aff1 T A 5: 103,842,265 M867K possibly damaging Het
Apba3 T A 10: 81,271,033 S225T Het
Aplp1 T A 7: 30,442,350 T228S probably benign Het
Arhgap18 A G 10: 26,854,890 D188G probably benign Het
BC024063 T A 10: 82,109,072 S175R possibly damaging Het
BC055324 A G 1: 163,986,945 I143T probably damaging Het
Bloc1s6 T G 2: 122,738,628 S2R probably damaging Het
Cd209b A G 8: 3,924,245 I119T possibly damaging Het
Cdk8 T C 5: 146,231,739 V16A probably damaging Het
Cep295 A G 9: 15,341,608 M308T probably benign Het
Cfap53 T A 18: 74,283,201 Y2N probably damaging Het
Col28a1 T A 6: 8,014,993 D804V probably damaging Het
Cyp2c40 A T 19: 39,773,873 D443E probably damaging Het
Cyp2d9 A G 15: 82,454,371 D202G possibly damaging Het
D3Ertd254e C A 3: 36,165,753 H642N possibly damaging Het
Dchs1 G A 7: 105,765,919 A686V probably benign Het
Egf A T 3: 129,678,377 N1199K probably benign Het
Eva1a A G 6: 82,091,874 R61G possibly damaging Het
Exoc6 T A 19: 37,609,030 D626E probably benign Het
Exosc10 T C 4: 148,579,459 probably null Het
Gm12888 T C 4: 121,319,403 Q67R probably null Het
Gm16485 A G 9: 8,972,318 S62G unknown Het
Gm5416 G A 16: 36,217,699 V69I probably benign Het
Gng4 T C 13: 13,825,311 I55T probably damaging Het
Gpihbp1 A G 15: 75,597,981 S182G possibly damaging Het
Hax1 T C 3: 89,995,820 R251G probably damaging Het
Igf2bp2 G A 16: 22,081,752 T213I probably damaging Het
Il23a T A 10: 128,297,558 K66* probably null Het
Itga2 A T 13: 114,877,762 L210* probably null Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Matr3 T A 18: 35,579,302 M389K possibly damaging Het
Mettl15 T C 2: 109,093,099 D326G probably damaging Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Naa15 T A 3: 51,451,381 N362K probably benign Het
Necab2 T C 8: 119,462,564 Y158H probably damaging Het
Nphp3 T A 9: 104,020,781 L523Q probably damaging Het
Nphs1 T G 7: 30,465,601 F540V possibly damaging Het
Olfr267 A G 4: 58,785,320 I134T probably benign Het
Olfr332 A G 11: 58,490,524 V77A probably damaging Het
Olfr476 A T 7: 107,968,317 R307* probably null Het
Ppa1 A T 10: 61,661,005 I91F probably damaging Het
Prdm6 C A 18: 53,464,947 A127D unknown Het
Prdm8 T C 5: 98,186,316 F581L probably damaging Het
Rbbp6 T C 7: 122,990,205 I372T probably damaging Het
Rnf144b A G 13: 47,242,872 I228M probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Setd2 T C 9: 110,545,317 probably null Het
Sez6l T C 5: 112,465,958 H441R possibly damaging Het
Shbg G A 11: 69,615,604 L327F probably benign Het
Sik3 C T 9: 46,212,241 Q1113* probably null Het
Smad2 T A 18: 76,262,502 I4N possibly damaging Het
Sult2b1 T A 7: 45,742,110 E84V probably damaging Het
Tbc1d8 A G 1: 39,405,393 Y162H Het
Tedc2 A G 17: 24,217,731 L308P probably damaging Het
Tmc5 T C 7: 118,634,041 V26A probably benign Het
Tmem120b T A 5: 123,104,503 N181K possibly damaging Het
Tmem229b T G 12: 78,964,674 N161T possibly damaging Het
Tmem43 A C 6: 91,482,309 D254A probably benign Het
Trpv6 T C 6: 41,626,140 D266G probably benign Het
Tspan9 A G 6: 127,966,754 I102T possibly damaging Het
Ung A G 5: 114,132,105 probably benign Het
Upp2 C T 2: 58,777,984 H230Y probably damaging Het
Vmn1r184 G A 7: 26,267,120 S97N possibly damaging Het
Vmn2r73 A T 7: 85,872,723 V136E possibly damaging Het
Wdr20rt T C 12: 65,226,144 V127A probably damaging Het
Yme1l1 T A 2: 23,173,046 F210I probably damaging Het
Yrdc T C 4: 124,854,018 probably null Het
Zfhx4 G T 3: 5,399,252 R1515L probably damaging Het
Zfhx4 C T 3: 5,401,157 P2150L probably damaging Het
Zfp988 C T 4: 147,331,993 P295S possibly damaging Het
Other mutations in Mta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Mta1 APN 12 113120908 missense possibly damaging 0.94
IGL02250:Mta1 APN 12 113126798 missense possibly damaging 0.59
IGL02391:Mta1 APN 12 113136583 missense possibly damaging 0.79
IGL02670:Mta1 APN 12 113130121 missense probably damaging 1.00
PIT4382001:Mta1 UTSW 12 113133250 missense probably benign 0.06
R0361:Mta1 UTSW 12 113133341 splice site probably null
R0496:Mta1 UTSW 12 113131321 nonsense probably null
R1774:Mta1 UTSW 12 113128039 missense probably damaging 1.00
R1870:Mta1 UTSW 12 113128074 missense possibly damaging 0.73
R1976:Mta1 UTSW 12 113136306 missense probably damaging 0.97
R2110:Mta1 UTSW 12 113131628 missense probably damaging 1.00
R2111:Mta1 UTSW 12 113131628 missense probably damaging 1.00
R2184:Mta1 UTSW 12 113130195 critical splice donor site probably null
R2274:Mta1 UTSW 12 113128150 missense probably damaging 1.00
R4087:Mta1 UTSW 12 113112182 missense probably damaging 1.00
R4231:Mta1 UTSW 12 113135827 missense possibly damaging 0.95
R4916:Mta1 UTSW 12 113136540 missense probably benign 0.17
R5032:Mta1 UTSW 12 113133525 splice site probably null
R5271:Mta1 UTSW 12 113131957 missense probably damaging 0.99
R5344:Mta1 UTSW 12 113131566 splice site probably benign
R5392:Mta1 UTSW 12 113133236 missense probably benign
R5656:Mta1 UTSW 12 113123139 missense probably damaging 1.00
R5903:Mta1 UTSW 12 113136619 missense probably damaging 1.00
R6168:Mta1 UTSW 12 113123119 missense probably damaging 0.96
R7091:Mta1 UTSW 12 113136402 missense probably damaging 1.00
R7334:Mta1 UTSW 12 113126798 missense possibly damaging 0.59
R7408:Mta1 UTSW 12 113131468 critical splice donor site probably null
R7889:Mta1 UTSW 12 113131688 missense probably benign 0.02
R8136:Mta1 UTSW 12 113131678 missense probably damaging 1.00
R8176:Mta1 UTSW 12 113120836 missense probably benign 0.00
R8385:Mta1 UTSW 12 113131465 missense probably benign
R8398:Mta1 UTSW 12 113131622 missense possibly damaging 0.83
R9132:Mta1 UTSW 12 113136405 missense probably damaging 1.00
R9418:Mta1 UTSW 12 113131367 missense probably damaging 1.00
Z1088:Mta1 UTSW 12 113133200 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CAGGGTACTGTCTTCCTGTG -3'
(R):5'- GCTCATCATTGACTGGTGCAG -3'

Sequencing Primer
(F):5'- GGGTACTGTCTTCCTGTGTCCATAC -3'
(R):5'- CGCAGGGCAATGGGTTTG -3'
Posted On 2022-01-20