Incidental Mutation 'R9160:Aspm'
ID 695624
Institutional Source Beutler Lab
Gene Symbol Aspm
Ensembl Gene ENSMUSG00000033952
Gene Name abnormal spindle microtubule assembly
Synonyms Sha1, D330028K02Rik, Calmbp1, MCPH5, Aspm
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9160 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 139382510-139421829 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 139417862 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 2911 (L2911S)
Ref Sequence ENSEMBL: ENSMUSP00000059159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053364] [ENSMUST00000200083]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000053364
AA Change: L2911S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059159
Gene: ENSMUSG00000033952
AA Change: L2911S

DomainStartEndE-ValueType
Pfam:ASH 29 126 8.9e-35 PFAM
low complexity region 855 861 N/A INTRINSIC
CH 890 1022 2.04e0 SMART
CH 1080 1224 5.56e-9 SMART
IQ 1233 1255 7.57e0 SMART
IQ 1259 1281 1.12e1 SMART
IQ 1282 1304 3.73e-1 SMART
IQ 1314 1336 2.41e-4 SMART
IQ 1360 1382 2.12e1 SMART
IQ 1387 1408 7.61e1 SMART
IQ 1409 1431 6.97e0 SMART
IQ 1432 1452 1.44e1 SMART
IQ 1453 1475 1.15e-1 SMART
IQ 1476 1495 1.66e2 SMART
IQ 1503 1525 1.65e-2 SMART
IQ 1526 1548 1.32e1 SMART
IQ 1549 1571 1.48e1 SMART
IQ 1572 1594 2.5e1 SMART
IQ 1599 1621 2.58e-4 SMART
IQ 1622 1644 6.7e-3 SMART
IQ 1645 1667 4.25e1 SMART
IQ 1668 1694 1.03e2 SMART
IQ 1695 1717 2.33e-2 SMART
IQ 1718 1740 7.79e0 SMART
IQ 1741 1763 1.57e2 SMART
IQ 1768 1790 2.68e-2 SMART
IQ 1791 1813 5.83e-3 SMART
IQ 1814 1836 5.93e1 SMART
IQ 1841 1863 1.92e-3 SMART
IQ 1864 1886 3.79e-2 SMART
IQ 1914 1936 4.11e0 SMART
IQ 1937 1959 1.87e-1 SMART
IQ 1960 1982 6.27e1 SMART
IQ 1987 2009 8.25e-3 SMART
IQ 2010 2032 5.73e0 SMART
IQ 2060 2082 1.39e0 SMART
IQ 2083 2105 4.62e1 SMART
IQ 2133 2155 5.58e0 SMART
IQ 2156 2178 7.07e-2 SMART
IQ 2206 2228 1.18e-3 SMART
IQ 2229 2251 4.59e0 SMART
IQ 2278 2300 1.85e-5 SMART
IQ 2301 2323 8.13e-2 SMART
IQ 2342 2364 9.62e-4 SMART
IQ 2365 2387 4.12e-3 SMART
IQ 2415 2437 7.58e-2 SMART
IQ 2438 2460 2.6e0 SMART
IQ 2490 2512 1.68e-3 SMART
IQ 2513 2535 8.51e1 SMART
IQ 2560 2582 2.14e-1 SMART
IQ 2601 2623 8.46e0 SMART
IQ 2647 2669 1.15e1 SMART
IQ 2673 2695 1.95e-4 SMART
IQ 2696 2718 4.13e1 SMART
IQ 2723 2745 1.02e-2 SMART
IQ 2761 2783 3.14e2 SMART
IQ 2784 2806 1e1 SMART
IQ 2825 2847 2.43e0 SMART
IQ 2848 2870 4.6e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000200083
AA Change: L1646S

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142880
Gene: ENSMUSG00000033952
AA Change: L1646S

DomainStartEndE-ValueType
low complexity region 855 861 N/A INTRINSIC
CH 890 1022 2.04e0 SMART
CH 1080 1224 5.56e-9 SMART
IQ 1233 1255 7.57e0 SMART
IQ 1259 1281 1.12e1 SMART
IQ 1282 1304 3.73e-1 SMART
IQ 1314 1336 1.25e1 SMART
IQ 1337 1358 2.96e1 SMART
IQ 1382 1404 1.15e1 SMART
IQ 1408 1430 1.95e-4 SMART
IQ 1431 1453 4.13e1 SMART
IQ 1458 1480 1.02e-2 SMART
IQ 1496 1518 3.14e2 SMART
IQ 1519 1541 1e1 SMART
IQ 1560 1582 2.43e0 SMART
IQ 1583 1605 4.6e-1 SMART
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the human ortholog of the Drosophila melanogaster 'abnormal spindle' gene (asp), which is essential for normal mitotic spindle function in embryonic neuroblasts. Studies in mouse also suggest a role of this gene in mitotic spindle regulation, with a preferential role in regulating neurogenesis. Mutations in this gene are associated with microcephaly primary type 5. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for protein-truncating gene trap mutations of this gene exhibit decreased body weight, microcephaly, a severe reduction in brain, testis and ovary weight, oligozoospermia and asthenospermia, and reduced fertility in both sexes. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 G A 16: 20,379,246 (GRCm39) R704H possibly damaging Het
Akap13 T C 7: 75,385,526 (GRCm39) F533L possibly damaging Het
Ank3 G A 10: 69,838,304 (GRCm39) V1771I unknown Het
Atp2b4 T C 1: 133,660,143 (GRCm39) I380V probably benign Het
C2cd3 T A 7: 100,075,236 (GRCm39) L739I Het
Cacng6 T C 7: 3,483,406 (GRCm39) S245P probably benign Het
Chd5 A G 4: 152,469,916 (GRCm39) S1830G probably damaging Het
Col20a1 T C 2: 180,641,538 (GRCm39) M660T probably benign Het
Dnajc6 G A 4: 101,470,258 (GRCm39) probably benign Het
Dock7 A G 4: 98,857,962 (GRCm39) S1451P unknown Het
Ehd4 A G 2: 119,967,440 (GRCm39) V118A probably damaging Het
Espl1 A G 15: 102,206,953 (GRCm39) D139G probably damaging Het
Fer1l6 G A 15: 58,515,715 (GRCm39) E1601K possibly damaging Het
Fermt3 A T 19: 6,991,785 (GRCm39) L142Q probably damaging Het
Gfral A T 9: 76,104,372 (GRCm39) N213K possibly damaging Het
Gria4 A G 9: 4,424,412 (GRCm39) F818L probably damaging Het
H2-Eb1 A T 17: 34,528,831 (GRCm39) R121* probably null Het
Hoxd9 A G 2: 74,529,761 (GRCm39) D339G unknown Het
Hpn G T 7: 30,808,402 (GRCm39) P78T probably benign Het
Inpp4b T A 8: 82,610,782 (GRCm39) V175E possibly damaging Het
Itpr2 A G 6: 146,276,099 (GRCm39) L736P probably damaging Het
Klhl6 G T 16: 19,775,772 (GRCm39) P262Q probably damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Mc5r A T 18: 68,472,205 (GRCm39) Y188F probably damaging Het
Mob1b T C 5: 88,904,017 (GRCm39) S218P probably benign Het
Mrgprb2 T C 7: 48,201,982 (GRCm39) I248V possibly damaging Het
Muc5ac T C 7: 141,363,529 (GRCm39) I2280T unknown Het
Or1e29 A T 11: 73,667,881 (GRCm39) S91T probably benign Het
Or2ah1 T A 2: 85,653,318 (GRCm39) M1K probably null Het
Or2o1 G T 11: 49,051,261 (GRCm39) W140L probably damaging Het
Or5j3 A T 2: 86,128,330 (GRCm39) T57S probably benign Het
Pcdhga8 T A 18: 37,860,465 (GRCm39) I507N probably damaging Het
Pkd1l2 T C 8: 117,767,408 (GRCm39) D1294G possibly damaging Het
Psg28 A G 7: 18,164,640 (GRCm39) L24P probably damaging Het
Ptk2 A T 15: 73,087,933 (GRCm39) D868E probably benign Het
Ptpn6 G C 6: 124,705,135 (GRCm39) R264G possibly damaging Het
Rnf10 T A 5: 115,398,249 (GRCm39) M95L probably benign Het
Rnf40 C T 7: 127,190,993 (GRCm39) T326I probably damaging Het
Rp1 G T 1: 4,416,720 (GRCm39) T1464K probably benign Het
Satb1 T C 17: 52,047,053 (GRCm39) E723G probably benign Het
Scgb3a2 T A 18: 43,900,445 (GRCm39) probably benign Het
Sidt2 A G 9: 45,858,280 (GRCm39) probably null Het
Sorcs1 A T 19: 50,213,658 (GRCm39) C690S probably damaging Het
Spag16 T A 1: 69,962,873 (GRCm39) M340K probably benign Het
Stk3 A G 15: 35,099,611 (GRCm39) V107A probably damaging Het
Tlr1 T A 5: 65,083,653 (GRCm39) H308L probably benign Het
Tmx2 A G 2: 84,503,907 (GRCm39) F162S probably damaging Het
Vmn2r57 C T 7: 41,076,159 (GRCm39) S451N possibly damaging Het
Zbtb49 T A 5: 38,363,246 (GRCm39) I446F probably damaging Het
Zdhhc17 A T 10: 110,783,189 (GRCm39) I493N probably damaging Het
Other mutations in Aspm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Aspm APN 1 139,406,429 (GRCm39) missense probably damaging 1.00
IGL00594:Aspm APN 1 139,415,160 (GRCm39) splice site probably benign
IGL00808:Aspm APN 1 139,389,214 (GRCm39) missense probably benign 0.03
IGL00897:Aspm APN 1 139,405,145 (GRCm39) missense probably damaging 0.98
IGL01024:Aspm APN 1 139,405,862 (GRCm39) missense possibly damaging 0.66
IGL01410:Aspm APN 1 139,410,182 (GRCm39) missense probably benign 0.25
IGL01588:Aspm APN 1 139,405,900 (GRCm39) missense probably benign 0.11
IGL01610:Aspm APN 1 139,417,408 (GRCm39) nonsense probably null
IGL01633:Aspm APN 1 139,408,574 (GRCm39) missense possibly damaging 0.93
IGL01982:Aspm APN 1 139,419,326 (GRCm39) missense probably benign 0.12
IGL02429:Aspm APN 1 139,407,548 (GRCm39) missense probably benign 0.27
IGL02468:Aspm APN 1 139,408,688 (GRCm39) missense probably damaging 1.00
IGL02519:Aspm APN 1 139,389,665 (GRCm39) splice site probably benign
IGL02526:Aspm APN 1 139,417,457 (GRCm39) missense probably benign 0.03
IGL02716:Aspm APN 1 139,407,425 (GRCm39) missense probably damaging 1.00
IGL02876:Aspm APN 1 139,401,391 (GRCm39) missense probably damaging 1.00
IGL02953:Aspm APN 1 139,385,157 (GRCm39) missense probably benign 0.01
IGL03275:Aspm APN 1 139,415,033 (GRCm39) missense probably damaging 1.00
Stemware UTSW 1 139,405,197 (GRCm39) nonsense probably null
3-1:Aspm UTSW 1 139,385,279 (GRCm39) missense probably benign
R0016:Aspm UTSW 1 139,407,282 (GRCm39) missense probably benign 0.01
R0016:Aspm UTSW 1 139,407,282 (GRCm39) missense probably benign 0.01
R0106:Aspm UTSW 1 139,404,614 (GRCm39) missense probably benign 0.02
R0106:Aspm UTSW 1 139,404,614 (GRCm39) missense probably benign 0.02
R0140:Aspm UTSW 1 139,408,379 (GRCm39) missense probably benign 0.00
R0195:Aspm UTSW 1 139,406,873 (GRCm39) missense probably damaging 1.00
R0217:Aspm UTSW 1 139,385,618 (GRCm39) missense possibly damaging 0.46
R0276:Aspm UTSW 1 139,406,209 (GRCm39) missense possibly damaging 0.95
R0309:Aspm UTSW 1 139,410,249 (GRCm39) splice site probably benign
R0466:Aspm UTSW 1 139,405,639 (GRCm39) missense probably damaging 1.00
R0520:Aspm UTSW 1 139,406,558 (GRCm39) missense possibly damaging 0.51
R0615:Aspm UTSW 1 139,415,027 (GRCm39) missense probably damaging 1.00
R0626:Aspm UTSW 1 139,419,339 (GRCm39) missense probably damaging 1.00
R0660:Aspm UTSW 1 139,385,502 (GRCm39) missense probably benign 0.03
R0751:Aspm UTSW 1 139,384,636 (GRCm39) splice site probably benign
R0830:Aspm UTSW 1 139,401,992 (GRCm39) missense probably damaging 0.99
R1109:Aspm UTSW 1 139,384,496 (GRCm39) missense probably damaging 0.99
R1114:Aspm UTSW 1 139,389,662 (GRCm39) splice site probably benign
R1130:Aspm UTSW 1 139,405,572 (GRCm39) missense possibly damaging 0.90
R1298:Aspm UTSW 1 139,385,157 (GRCm39) missense probably benign 0.01
R1386:Aspm UTSW 1 139,385,361 (GRCm39) missense probably benign 0.03
R1386:Aspm UTSW 1 139,406,710 (GRCm39) missense possibly damaging 0.80
R1557:Aspm UTSW 1 139,396,406 (GRCm39) missense probably benign 0.01
R1625:Aspm UTSW 1 139,408,777 (GRCm39) missense probably benign 0.01
R1728:Aspm UTSW 1 139,401,312 (GRCm39) missense probably benign
R1729:Aspm UTSW 1 139,401,312 (GRCm39) missense probably benign
R1730:Aspm UTSW 1 139,401,312 (GRCm39) missense probably benign
R1733:Aspm UTSW 1 139,384,855 (GRCm39) missense probably benign 0.27
R1739:Aspm UTSW 1 139,401,312 (GRCm39) missense probably benign
R1762:Aspm UTSW 1 139,401,312 (GRCm39) missense probably benign
R1783:Aspm UTSW 1 139,401,312 (GRCm39) missense probably benign
R1784:Aspm UTSW 1 139,401,312 (GRCm39) missense probably benign
R1785:Aspm UTSW 1 139,401,312 (GRCm39) missense probably benign
R1793:Aspm UTSW 1 139,385,079 (GRCm39) missense probably benign 0.00
R1893:Aspm UTSW 1 139,407,605 (GRCm39) missense probably damaging 1.00
R1911:Aspm UTSW 1 139,405,832 (GRCm39) missense probably benign 0.06
R2103:Aspm UTSW 1 139,419,403 (GRCm39) missense probably damaging 0.99
R2128:Aspm UTSW 1 139,385,373 (GRCm39) missense probably benign 0.14
R2129:Aspm UTSW 1 139,385,373 (GRCm39) missense probably benign 0.14
R2239:Aspm UTSW 1 139,384,584 (GRCm39) missense possibly damaging 0.67
R2352:Aspm UTSW 1 139,385,300 (GRCm39) missense probably benign 0.02
R2353:Aspm UTSW 1 139,405,435 (GRCm39) missense probably damaging 1.00
R2380:Aspm UTSW 1 139,407,086 (GRCm39) missense probably damaging 1.00
R2413:Aspm UTSW 1 139,405,495 (GRCm39) missense probably damaging 1.00
R2421:Aspm UTSW 1 139,416,225 (GRCm39) missense possibly damaging 0.49
R3607:Aspm UTSW 1 139,408,406 (GRCm39) missense probably benign 0.13
R3711:Aspm UTSW 1 139,385,838 (GRCm39) missense probably benign 0.17
R3718:Aspm UTSW 1 139,418,165 (GRCm39) missense probably benign 0.31
R3718:Aspm UTSW 1 139,408,627 (GRCm39) missense probably benign 0.09
R3741:Aspm UTSW 1 139,406,357 (GRCm39) missense possibly damaging 0.47
R3788:Aspm UTSW 1 139,390,941 (GRCm39) missense probably damaging 1.00
R3838:Aspm UTSW 1 139,405,792 (GRCm39) missense probably benign 0.24
R3839:Aspm UTSW 1 139,405,792 (GRCm39) missense probably benign 0.24
R3849:Aspm UTSW 1 139,386,024 (GRCm39) missense probably benign 0.21
R4075:Aspm UTSW 1 139,402,023 (GRCm39) missense probably damaging 1.00
R4080:Aspm UTSW 1 139,398,493 (GRCm39) missense probably damaging 1.00
R4463:Aspm UTSW 1 139,382,748 (GRCm39) missense possibly damaging 0.95
R4537:Aspm UTSW 1 139,402,041 (GRCm39) missense probably benign 0.01
R4547:Aspm UTSW 1 139,405,925 (GRCm39) missense possibly damaging 0.75
R4573:Aspm UTSW 1 139,407,245 (GRCm39) missense probably damaging 0.98
R4680:Aspm UTSW 1 139,408,409 (GRCm39) missense probably benign 0.05
R4807:Aspm UTSW 1 139,405,657 (GRCm39) missense probably damaging 1.00
R4840:Aspm UTSW 1 139,398,269 (GRCm39) missense possibly damaging 0.83
R4854:Aspm UTSW 1 139,405,810 (GRCm39) nonsense probably null
R4859:Aspm UTSW 1 139,397,131 (GRCm39) missense probably damaging 1.00
R4893:Aspm UTSW 1 139,417,577 (GRCm39) critical splice donor site probably null
R4910:Aspm UTSW 1 139,419,281 (GRCm39) missense probably damaging 1.00
R4953:Aspm UTSW 1 139,399,472 (GRCm39) missense probably benign 0.00
R4974:Aspm UTSW 1 139,405,748 (GRCm39) missense probably benign 0.03
R4981:Aspm UTSW 1 139,398,498 (GRCm39) splice site probably null
R5082:Aspm UTSW 1 139,406,414 (GRCm39) nonsense probably null
R5223:Aspm UTSW 1 139,406,072 (GRCm39) missense probably damaging 1.00
R5268:Aspm UTSW 1 139,392,033 (GRCm39) missense probably damaging 1.00
R5371:Aspm UTSW 1 139,398,279 (GRCm39) nonsense probably null
R5377:Aspm UTSW 1 139,398,133 (GRCm39) splice site probably null
R5377:Aspm UTSW 1 139,385,221 (GRCm39) missense probably damaging 0.96
R5481:Aspm UTSW 1 139,384,799 (GRCm39) missense possibly damaging 0.85
R5513:Aspm UTSW 1 139,410,136 (GRCm39) missense probably damaging 1.00
R5578:Aspm UTSW 1 139,398,455 (GRCm39) missense probably damaging 1.00
R5649:Aspm UTSW 1 139,407,407 (GRCm39) missense probably benign
R5685:Aspm UTSW 1 139,415,026 (GRCm39) missense probably benign 0.10
R5695:Aspm UTSW 1 139,407,407 (GRCm39) missense probably benign
R5766:Aspm UTSW 1 139,406,740 (GRCm39) missense probably damaging 0.99
R5964:Aspm UTSW 1 139,382,965 (GRCm39) intron probably benign
R5993:Aspm UTSW 1 139,407,269 (GRCm39) missense probably benign 0.28
R6027:Aspm UTSW 1 139,390,794 (GRCm39) missense probably damaging 1.00
R6029:Aspm UTSW 1 139,408,728 (GRCm39) missense possibly damaging 0.83
R6102:Aspm UTSW 1 139,405,197 (GRCm39) nonsense probably null
R6188:Aspm UTSW 1 139,406,977 (GRCm39) missense possibly damaging 0.79
R6257:Aspm UTSW 1 139,409,791 (GRCm39) splice site probably null
R6433:Aspm UTSW 1 139,401,421 (GRCm39) missense probably damaging 1.00
R6682:Aspm UTSW 1 139,385,460 (GRCm39) missense possibly damaging 0.67
R6763:Aspm UTSW 1 139,398,255 (GRCm39) missense possibly damaging 0.64
R6798:Aspm UTSW 1 139,396,423 (GRCm39) missense possibly damaging 0.66
R6815:Aspm UTSW 1 139,407,880 (GRCm39) missense probably benign 0.04
R6854:Aspm UTSW 1 139,390,920 (GRCm39) missense possibly damaging 0.90
R6928:Aspm UTSW 1 139,407,944 (GRCm39) nonsense probably null
R6943:Aspm UTSW 1 139,408,280 (GRCm39) missense probably damaging 1.00
R6979:Aspm UTSW 1 139,408,223 (GRCm39) missense probably damaging 1.00
R6998:Aspm UTSW 1 139,397,210 (GRCm39) missense probably damaging 1.00
R7126:Aspm UTSW 1 139,408,541 (GRCm39) missense probably benign 0.27
R7237:Aspm UTSW 1 139,405,667 (GRCm39) missense possibly damaging 0.81
R7240:Aspm UTSW 1 139,406,389 (GRCm39) nonsense probably null
R7272:Aspm UTSW 1 139,386,066 (GRCm39) missense probably benign 0.14
R7427:Aspm UTSW 1 139,385,354 (GRCm39) missense probably benign 0.01
R7519:Aspm UTSW 1 139,418,074 (GRCm39) missense possibly damaging 0.53
R7776:Aspm UTSW 1 139,407,584 (GRCm39) missense possibly damaging 0.85
R7875:Aspm UTSW 1 139,382,872 (GRCm39) missense probably benign 0.02
R7883:Aspm UTSW 1 139,406,405 (GRCm39) missense possibly damaging 0.47
R7964:Aspm UTSW 1 139,408,424 (GRCm39) missense probably damaging 1.00
R8012:Aspm UTSW 1 139,385,202 (GRCm39) missense probably benign 0.03
R8029:Aspm UTSW 1 139,399,370 (GRCm39) missense probably benign 0.00
R8233:Aspm UTSW 1 139,385,042 (GRCm39) missense probably benign 0.28
R8277:Aspm UTSW 1 139,382,748 (GRCm39) missense probably damaging 1.00
R8345:Aspm UTSW 1 139,392,011 (GRCm39) nonsense probably null
R8491:Aspm UTSW 1 139,385,433 (GRCm39) missense probably damaging 0.98
R8511:Aspm UTSW 1 139,385,046 (GRCm39) missense probably damaging 1.00
R8557:Aspm UTSW 1 139,384,494 (GRCm39) missense probably benign 0.01
R8927:Aspm UTSW 1 139,418,125 (GRCm39) nonsense probably null
R8928:Aspm UTSW 1 139,418,125 (GRCm39) nonsense probably null
R8950:Aspm UTSW 1 139,406,690 (GRCm39) missense probably damaging 1.00
R9033:Aspm UTSW 1 139,405,865 (GRCm39) missense probably damaging 1.00
R9083:Aspm UTSW 1 139,421,436 (GRCm39) missense possibly damaging 0.70
R9133:Aspm UTSW 1 139,419,266 (GRCm39) missense probably damaging 1.00
R9179:Aspm UTSW 1 139,404,453 (GRCm39) missense probably damaging 1.00
R9265:Aspm UTSW 1 139,389,182 (GRCm39) missense probably benign 0.24
R9400:Aspm UTSW 1 139,407,641 (GRCm39) missense probably damaging 1.00
R9419:Aspm UTSW 1 139,384,923 (GRCm39) missense probably benign 0.29
R9454:Aspm UTSW 1 139,408,732 (GRCm39) missense probably benign 0.00
R9517:Aspm UTSW 1 139,407,167 (GRCm39) missense probably damaging 1.00
R9524:Aspm UTSW 1 139,408,607 (GRCm39) missense probably damaging 1.00
R9544:Aspm UTSW 1 139,385,523 (GRCm39) missense probably benign 0.01
R9640:Aspm UTSW 1 139,408,010 (GRCm39) missense possibly damaging 0.88
R9698:Aspm UTSW 1 139,389,646 (GRCm39) missense probably benign 0.28
R9790:Aspm UTSW 1 139,408,375 (GRCm39) missense probably damaging 0.98
R9791:Aspm UTSW 1 139,408,375 (GRCm39) missense probably damaging 0.98
R9794:Aspm UTSW 1 139,406,480 (GRCm39) missense probably damaging 0.99
X0063:Aspm UTSW 1 139,385,828 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTGTTACACCTGTTTGTTAAGGC -3'
(R):5'- AGCCATATTCTCACAGCAAAGTG -3'

Sequencing Primer
(F):5'- TAAGGCATTATGGAGAGGCTATTC -3'
(R):5'- CCATATTCTCACAGCAAAGTGGAGAG -3'
Posted On 2022-01-20