Incidental Mutation 'R9160:Olfr1018'
ID 695627
Institutional Source Beutler Lab
Gene Symbol Olfr1018
Ensembl Gene ENSMUSG00000043892
Gene Name olfactory receptor 1018
Synonyms GA_x6K02T2Q125-47301584-47302519, MOR260-5
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.563) question?
Stock # R9160 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 85818479-85824221 bp(+) (GRCm38)
Type of Mutation start codon destroyed
DNA Base Change (assembly) T to A at 85822974 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000151090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054201] [ENSMUST00000214416]
AlphaFold A2ASV3
Predicted Effect probably null
Transcript: ENSMUST00000054201
AA Change: M1K

PolyPhen 2 Score 0.371 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000050833
Gene: ENSMUSG00000043892
AA Change: M1K

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 4.1e-59 PFAM
Pfam:7tm_1 42 291 1.2e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214416
AA Change: M1K

PolyPhen 2 Score 0.371 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 G A 16: 20,560,496 R704H possibly damaging Het
Akap13 T C 7: 75,735,778 F533L possibly damaging Het
Ank3 G A 10: 70,002,474 V1771I unknown Het
Aspm T C 1: 139,490,124 L2911S probably damaging Het
Atp2b4 T C 1: 133,732,405 I380V probably benign Het
C2cd3 T A 7: 100,426,029 L739I Het
Cacng6 T C 7: 3,434,890 S245P probably benign Het
Chd5 A G 4: 152,385,459 S1830G probably damaging Het
Col20a1 T C 2: 180,999,745 M660T probably benign Het
Dnajc6 G A 4: 101,613,061 probably benign Het
Dock7 A G 4: 98,969,725 S1451P unknown Het
Ehd4 A G 2: 120,136,959 V118A probably damaging Het
Espl1 A G 15: 102,298,518 D139G probably damaging Het
Fer1l6 G A 15: 58,643,866 E1601K possibly damaging Het
Fermt3 A T 19: 7,014,417 L142Q probably damaging Het
Gfral A T 9: 76,197,090 N213K possibly damaging Het
Gria4 A G 9: 4,424,412 F818L probably damaging Het
H2-Eb1 A T 17: 34,309,857 R121* probably null Het
Hoxd9 A G 2: 74,699,417 D339G unknown Het
Hpn G T 7: 31,108,977 P78T probably benign Het
Inpp4b T A 8: 81,884,153 V175E possibly damaging Het
Itpr2 A G 6: 146,374,601 L736P probably damaging Het
Klhl6 G T 16: 19,957,022 P262Q probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mc5r A T 18: 68,339,134 Y188F probably damaging Het
Mob1b T C 5: 88,756,158 S218P probably benign Het
Mrgprb2 T C 7: 48,552,234 I248V possibly damaging Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Olfr1052 A T 2: 86,297,986 T57S probably benign Het
Olfr1394 G T 11: 49,160,434 W140L probably damaging Het
Olfr389 A T 11: 73,777,055 S91T probably benign Het
Pcdhga8 T A 18: 37,727,412 I507N probably damaging Het
Pkd1l2 T C 8: 117,040,669 D1294G possibly damaging Het
Psg28 A G 7: 18,430,715 L24P probably damaging Het
Ptk2 A T 15: 73,216,084 D868E probably benign Het
Ptpn6 G C 6: 124,728,172 R264G possibly damaging Het
Rnf10 T A 5: 115,260,190 M95L probably benign Het
Rnf40 C T 7: 127,591,821 T326I probably damaging Het
Rp1 G T 1: 4,346,497 T1464K probably benign Het
Satb1 T C 17: 51,740,025 E723G probably benign Het
Scgb3a2 T A 18: 43,767,380 probably benign Het
Sidt2 A G 9: 45,946,982 probably null Het
Sorcs1 A T 19: 50,225,220 C690S probably damaging Het
Spag16 T A 1: 69,923,714 M340K probably benign Het
Stk3 A G 15: 35,099,465 V107A probably damaging Het
Tlr1 T A 5: 64,926,310 H308L probably benign Het
Tmx2 A G 2: 84,673,563 F162S probably damaging Het
Vmn2r57 C T 7: 41,426,735 S451N possibly damaging Het
Zbtb49 T A 5: 38,205,902 I446F probably damaging Het
Zdhhc17 A T 10: 110,947,328 I493N probably damaging Het
Other mutations in Olfr1018
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Olfr1018 APN 2 85822988 missense probably benign 0.00
IGL02795:Olfr1018 APN 2 85823512 nonsense probably null
IGL03189:Olfr1018 APN 2 85823558 missense probably benign 0.27
IGL03329:Olfr1018 APN 2 85823385 missense probably benign 0.02
IGL03400:Olfr1018 APN 2 85823750 missense probably damaging 1.00
G1patch:Olfr1018 UTSW 2 85823790 missense probably damaging 0.97
IGL02796:Olfr1018 UTSW 2 85823589 missense probably benign 0.00
R5322:Olfr1018 UTSW 2 85823187 missense probably damaging 0.99
R5597:Olfr1018 UTSW 2 85823460 missense probably damaging 0.96
R6521:Olfr1018 UTSW 2 85823450 missense probably benign 0.01
R6725:Olfr1018 UTSW 2 85823790 missense probably damaging 0.97
R7068:Olfr1018 UTSW 2 85823052 missense probably benign 0.00
R7105:Olfr1018 UTSW 2 85823880 missense probably benign 0.22
R8011:Olfr1018 UTSW 2 85823613 missense possibly damaging 0.90
R8294:Olfr1018 UTSW 2 85823187 missense probably damaging 0.99
Z1176:Olfr1018 UTSW 2 85823021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGAACATGGGGTGATTTTGACTG -3'
(R):5'- AGTGGATGTGTAGCAGATGTCC -3'

Sequencing Primer
(F):5'- ATGGGGTGATTTTGACTGGAAAAATG -3'
(R):5'- AGAAGTACATGGGGGTTTTCAGGC -3'
Posted On 2022-01-20