Incidental Mutation 'R9160:Col20a1'
ID 695630
Institutional Source Beutler Lab
Gene Symbol Col20a1
Ensembl Gene ENSMUSG00000016356
Gene Name collagen, type XX, alpha 1
Synonyms 1700051I12Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9160 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 180628328-180660156 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 180641538 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 660 (M660T)
Ref Sequence ENSEMBL: ENSMUSP00000104484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108856] [ENSMUST00000149179] [ENSMUST00000228434]
AlphaFold Q923P0
Predicted Effect probably benign
Transcript: ENSMUST00000108856
AA Change: M660T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104484
Gene: ENSMUSG00000016356
AA Change: M660T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 24 103 2.18e1 SMART
VWA 175 354 4.68e-55 SMART
FN3 375 453 6.2e-7 SMART
FN3 464 543 7.34e-9 SMART
FN3 555 633 8.18e-7 SMART
FN3 644 723 8.98e-4 SMART
FN3 738 817 1.43e-11 SMART
TSPN 840 1035 6.45e-31 SMART
Pfam:Collagen 1067 1125 3.8e-9 PFAM
Pfam:Collagen 1122 1174 7.4e-9 PFAM
Pfam:Collagen 1165 1223 3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149179
AA Change: M618T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115291
Gene: ENSMUSG00000016356
AA Change: M618T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 24 103 2.18e1 SMART
VWA 175 354 4.68e-55 SMART
FN3 375 453 6.2e-7 SMART
FN3 464 543 7.34e-9 SMART
FN3 555 633 8.18e-7 SMART
FN3 644 723 8.98e-4 SMART
FN3 738 817 1.43e-11 SMART
TSPN 840 1035 6.45e-31 SMART
low complexity region 1069 1106 N/A INTRINSIC
low complexity region 1108 1121 N/A INTRINSIC
low complexity region 1136 1155 N/A INTRINSIC
Blast:TSPN 1156 1202 2e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000152473
Predicted Effect probably benign
Transcript: ENSMUST00000228434
AA Change: M618T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 G A 16: 20,379,246 (GRCm39) R704H possibly damaging Het
Akap13 T C 7: 75,385,526 (GRCm39) F533L possibly damaging Het
Ank3 G A 10: 69,838,304 (GRCm39) V1771I unknown Het
Aspm T C 1: 139,417,862 (GRCm39) L2911S probably damaging Het
Atp2b4 T C 1: 133,660,143 (GRCm39) I380V probably benign Het
C2cd3 T A 7: 100,075,236 (GRCm39) L739I Het
Cacng6 T C 7: 3,483,406 (GRCm39) S245P probably benign Het
Chd5 A G 4: 152,469,916 (GRCm39) S1830G probably damaging Het
Dnajc6 G A 4: 101,470,258 (GRCm39) probably benign Het
Dock7 A G 4: 98,857,962 (GRCm39) S1451P unknown Het
Ehd4 A G 2: 119,967,440 (GRCm39) V118A probably damaging Het
Espl1 A G 15: 102,206,953 (GRCm39) D139G probably damaging Het
Fer1l6 G A 15: 58,515,715 (GRCm39) E1601K possibly damaging Het
Fermt3 A T 19: 6,991,785 (GRCm39) L142Q probably damaging Het
Gfral A T 9: 76,104,372 (GRCm39) N213K possibly damaging Het
Gria4 A G 9: 4,424,412 (GRCm39) F818L probably damaging Het
H2-Eb1 A T 17: 34,528,831 (GRCm39) R121* probably null Het
Hoxd9 A G 2: 74,529,761 (GRCm39) D339G unknown Het
Hpn G T 7: 30,808,402 (GRCm39) P78T probably benign Het
Inpp4b T A 8: 82,610,782 (GRCm39) V175E possibly damaging Het
Itpr2 A G 6: 146,276,099 (GRCm39) L736P probably damaging Het
Klhl6 G T 16: 19,775,772 (GRCm39) P262Q probably damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Mc5r A T 18: 68,472,205 (GRCm39) Y188F probably damaging Het
Mob1b T C 5: 88,904,017 (GRCm39) S218P probably benign Het
Mrgprb2 T C 7: 48,201,982 (GRCm39) I248V possibly damaging Het
Muc5ac T C 7: 141,363,529 (GRCm39) I2280T unknown Het
Or1e29 A T 11: 73,667,881 (GRCm39) S91T probably benign Het
Or2ah1 T A 2: 85,653,318 (GRCm39) M1K probably null Het
Or2o1 G T 11: 49,051,261 (GRCm39) W140L probably damaging Het
Or5j3 A T 2: 86,128,330 (GRCm39) T57S probably benign Het
Pcdhga8 T A 18: 37,860,465 (GRCm39) I507N probably damaging Het
Pkd1l2 T C 8: 117,767,408 (GRCm39) D1294G possibly damaging Het
Psg28 A G 7: 18,164,640 (GRCm39) L24P probably damaging Het
Ptk2 A T 15: 73,087,933 (GRCm39) D868E probably benign Het
Ptpn6 G C 6: 124,705,135 (GRCm39) R264G possibly damaging Het
Rnf10 T A 5: 115,398,249 (GRCm39) M95L probably benign Het
Rnf40 C T 7: 127,190,993 (GRCm39) T326I probably damaging Het
Rp1 G T 1: 4,416,720 (GRCm39) T1464K probably benign Het
Satb1 T C 17: 52,047,053 (GRCm39) E723G probably benign Het
Scgb3a2 T A 18: 43,900,445 (GRCm39) probably benign Het
Sidt2 A G 9: 45,858,280 (GRCm39) probably null Het
Sorcs1 A T 19: 50,213,658 (GRCm39) C690S probably damaging Het
Spag16 T A 1: 69,962,873 (GRCm39) M340K probably benign Het
Stk3 A G 15: 35,099,611 (GRCm39) V107A probably damaging Het
Tlr1 T A 5: 65,083,653 (GRCm39) H308L probably benign Het
Tmx2 A G 2: 84,503,907 (GRCm39) F162S probably damaging Het
Vmn2r57 C T 7: 41,076,159 (GRCm39) S451N possibly damaging Het
Zbtb49 T A 5: 38,363,246 (GRCm39) I446F probably damaging Het
Zdhhc17 A T 10: 110,783,189 (GRCm39) I493N probably damaging Het
Other mutations in Col20a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Col20a1 APN 2 180,645,272 (GRCm39) missense possibly damaging 0.93
IGL00975:Col20a1 APN 2 180,634,271 (GRCm39) missense probably damaging 1.00
IGL01094:Col20a1 APN 2 180,641,559 (GRCm39) missense probably damaging 0.99
IGL01388:Col20a1 APN 2 180,645,264 (GRCm39) missense probably benign 0.24
IGL01472:Col20a1 APN 2 180,649,625 (GRCm39) missense probably benign 0.44
IGL01936:Col20a1 APN 2 180,651,161 (GRCm39) splice site probably benign
IGL02133:Col20a1 APN 2 180,648,937 (GRCm39) missense probably damaging 1.00
IGL02318:Col20a1 APN 2 180,648,952 (GRCm39) missense probably damaging 0.99
IGL02576:Col20a1 APN 2 180,655,198 (GRCm39) nonsense probably null
IGL02822:Col20a1 APN 2 180,638,600 (GRCm39) missense probably damaging 1.00
IGL02898:Col20a1 APN 2 180,630,905 (GRCm39) nonsense probably null
IGL03056:Col20a1 APN 2 180,636,682 (GRCm39) missense probably damaging 1.00
IGL03189:Col20a1 APN 2 180,651,200 (GRCm39) nonsense probably null
IGL03196:Col20a1 APN 2 180,649,671 (GRCm39) splice site probably null
R0001:Col20a1 UTSW 2 180,626,205 (GRCm39) unclassified probably benign
R0200:Col20a1 UTSW 2 180,642,231 (GRCm39) missense probably damaging 1.00
R0384:Col20a1 UTSW 2 180,640,955 (GRCm39) missense probably benign 0.00
R0964:Col20a1 UTSW 2 180,626,278 (GRCm39) unclassified probably benign
R0975:Col20a1 UTSW 2 180,648,619 (GRCm39) missense possibly damaging 0.75
R1359:Col20a1 UTSW 2 180,641,585 (GRCm39) missense probably benign 0.02
R1395:Col20a1 UTSW 2 180,640,400 (GRCm39) missense probably damaging 0.99
R1470:Col20a1 UTSW 2 180,636,753 (GRCm39) missense probably benign 0.01
R1470:Col20a1 UTSW 2 180,636,753 (GRCm39) missense probably benign 0.01
R1508:Col20a1 UTSW 2 180,634,370 (GRCm39) missense probably damaging 0.98
R1865:Col20a1 UTSW 2 180,657,606 (GRCm39) missense possibly damaging 0.87
R1883:Col20a1 UTSW 2 180,634,703 (GRCm39) missense possibly damaging 0.52
R1884:Col20a1 UTSW 2 180,634,703 (GRCm39) missense possibly damaging 0.52
R1906:Col20a1 UTSW 2 180,640,490 (GRCm39) missense probably benign 0.00
R2020:Col20a1 UTSW 2 180,654,956 (GRCm39) critical splice donor site probably null
R2121:Col20a1 UTSW 2 180,638,249 (GRCm39) missense probably damaging 0.99
R2131:Col20a1 UTSW 2 180,634,366 (GRCm39) missense probably damaging 1.00
R2343:Col20a1 UTSW 2 180,643,124 (GRCm39) missense possibly damaging 0.73
R3153:Col20a1 UTSW 2 180,650,386 (GRCm39) missense probably damaging 1.00
R3430:Col20a1 UTSW 2 180,655,078 (GRCm39) nonsense probably null
R3547:Col20a1 UTSW 2 180,636,704 (GRCm39) missense probably damaging 1.00
R3844:Col20a1 UTSW 2 180,634,242 (GRCm39) missense probably damaging 1.00
R3914:Col20a1 UTSW 2 180,640,285 (GRCm39) missense probably benign 0.00
R4414:Col20a1 UTSW 2 180,643,043 (GRCm39) missense possibly damaging 0.92
R4711:Col20a1 UTSW 2 180,634,284 (GRCm39) missense probably damaging 1.00
R4760:Col20a1 UTSW 2 180,626,196 (GRCm39) unclassified probably benign
R4771:Col20a1 UTSW 2 180,630,917 (GRCm39) missense probably benign 0.17
R4809:Col20a1 UTSW 2 180,640,454 (GRCm39) missense probably damaging 1.00
R4872:Col20a1 UTSW 2 180,639,156 (GRCm39) missense possibly damaging 0.74
R5045:Col20a1 UTSW 2 180,648,638 (GRCm39) missense probably damaging 1.00
R5238:Col20a1 UTSW 2 180,640,379 (GRCm39) missense probably damaging 1.00
R5566:Col20a1 UTSW 2 180,628,316 (GRCm39) splice site probably null
R6389:Col20a1 UTSW 2 180,634,376 (GRCm39) splice site probably null
R6422:Col20a1 UTSW 2 180,656,612 (GRCm39) missense possibly damaging 0.75
R6924:Col20a1 UTSW 2 180,638,643 (GRCm39) missense probably damaging 1.00
R6982:Col20a1 UTSW 2 180,638,499 (GRCm39) missense probably benign 0.00
R7177:Col20a1 UTSW 2 180,636,007 (GRCm39) nonsense probably null
R7195:Col20a1 UTSW 2 180,649,024 (GRCm39) missense probably damaging 1.00
R7717:Col20a1 UTSW 2 180,649,408 (GRCm39) missense probably damaging 1.00
R7872:Col20a1 UTSW 2 180,628,371 (GRCm39) missense probably benign 0.14
R8183:Col20a1 UTSW 2 180,640,207 (GRCm39) missense
R8188:Col20a1 UTSW 2 180,658,126 (GRCm39) critical splice donor site probably null
R8331:Col20a1 UTSW 2 180,638,559 (GRCm39) missense possibly damaging 0.95
R8423:Col20a1 UTSW 2 180,640,498 (GRCm39) missense probably damaging 1.00
R8803:Col20a1 UTSW 2 180,643,131 (GRCm39) missense possibly damaging 0.75
R8849:Col20a1 UTSW 2 180,640,432 (GRCm39) missense probably damaging 1.00
R8855:Col20a1 UTSW 2 180,655,684 (GRCm39) missense
R8885:Col20a1 UTSW 2 180,640,296 (GRCm39) splice site probably benign
R9223:Col20a1 UTSW 2 180,648,528 (GRCm39) missense probably damaging 1.00
R9697:Col20a1 UTSW 2 180,641,577 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGAGATCCATGACTGATTGC -3'
(R):5'- CACATGGAGGAATGTCCCTG -3'

Sequencing Primer
(F):5'- CTGATTGCAGTTTTCCCATTTTGG -3'
(R):5'- GAATGTCCCTGGCCCCTTG -3'
Posted On 2022-01-20