Incidental Mutation 'R9160:Dock7'
ID 695631
Institutional Source Beutler Lab
Gene Symbol Dock7
Ensembl Gene ENSMUSG00000028556
Gene Name dedicator of cytokinesis 7
Synonyms m, LOC242555, 3110056M06Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9160 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 98824908-99009152 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98857962 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1451 (S1451P)
Ref Sequence ENSEMBL: ENSMUSP00000117797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030286] [ENSMUST00000075836] [ENSMUST00000127417] [ENSMUST00000205650]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000030286
AA Change: S1451P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556
AA Change: S1451P

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556
AA Change: S1421P

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124466
Predicted Effect unknown
Transcript: ENSMUST00000127417
AA Change: S1451P
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556
AA Change: S1451P

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205650
AA Change: S1421P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) that plays a role in axon formation and neuronal polarization. The encoded protein displays GEF activity toward RAC1 and RAC3 Rho small GTPases but not toward CDC42. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit coat color dilution, white tail tip, and on some genetic backgrounds a white belly spot. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 G A 16: 20,379,246 (GRCm39) R704H possibly damaging Het
Akap13 T C 7: 75,385,526 (GRCm39) F533L possibly damaging Het
Ank3 G A 10: 69,838,304 (GRCm39) V1771I unknown Het
Aspm T C 1: 139,417,862 (GRCm39) L2911S probably damaging Het
Atp2b4 T C 1: 133,660,143 (GRCm39) I380V probably benign Het
C2cd3 T A 7: 100,075,236 (GRCm39) L739I Het
Cacng6 T C 7: 3,483,406 (GRCm39) S245P probably benign Het
Chd5 A G 4: 152,469,916 (GRCm39) S1830G probably damaging Het
Col20a1 T C 2: 180,641,538 (GRCm39) M660T probably benign Het
Dnajc6 G A 4: 101,470,258 (GRCm39) probably benign Het
Ehd4 A G 2: 119,967,440 (GRCm39) V118A probably damaging Het
Espl1 A G 15: 102,206,953 (GRCm39) D139G probably damaging Het
Fer1l6 G A 15: 58,515,715 (GRCm39) E1601K possibly damaging Het
Fermt3 A T 19: 6,991,785 (GRCm39) L142Q probably damaging Het
Gfral A T 9: 76,104,372 (GRCm39) N213K possibly damaging Het
Gria4 A G 9: 4,424,412 (GRCm39) F818L probably damaging Het
H2-Eb1 A T 17: 34,528,831 (GRCm39) R121* probably null Het
Hoxd9 A G 2: 74,529,761 (GRCm39) D339G unknown Het
Hpn G T 7: 30,808,402 (GRCm39) P78T probably benign Het
Inpp4b T A 8: 82,610,782 (GRCm39) V175E possibly damaging Het
Itpr2 A G 6: 146,276,099 (GRCm39) L736P probably damaging Het
Klhl6 G T 16: 19,775,772 (GRCm39) P262Q probably damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Mc5r A T 18: 68,472,205 (GRCm39) Y188F probably damaging Het
Mob1b T C 5: 88,904,017 (GRCm39) S218P probably benign Het
Mrgprb2 T C 7: 48,201,982 (GRCm39) I248V possibly damaging Het
Muc5ac T C 7: 141,363,529 (GRCm39) I2280T unknown Het
Or1e29 A T 11: 73,667,881 (GRCm39) S91T probably benign Het
Or2ah1 T A 2: 85,653,318 (GRCm39) M1K probably null Het
Or2o1 G T 11: 49,051,261 (GRCm39) W140L probably damaging Het
Or5j3 A T 2: 86,128,330 (GRCm39) T57S probably benign Het
Pcdhga8 T A 18: 37,860,465 (GRCm39) I507N probably damaging Het
Pkd1l2 T C 8: 117,767,408 (GRCm39) D1294G possibly damaging Het
Psg28 A G 7: 18,164,640 (GRCm39) L24P probably damaging Het
Ptk2 A T 15: 73,087,933 (GRCm39) D868E probably benign Het
Ptpn6 G C 6: 124,705,135 (GRCm39) R264G possibly damaging Het
Rnf10 T A 5: 115,398,249 (GRCm39) M95L probably benign Het
Rnf40 C T 7: 127,190,993 (GRCm39) T326I probably damaging Het
Rp1 G T 1: 4,416,720 (GRCm39) T1464K probably benign Het
Satb1 T C 17: 52,047,053 (GRCm39) E723G probably benign Het
Scgb3a2 T A 18: 43,900,445 (GRCm39) probably benign Het
Sidt2 A G 9: 45,858,280 (GRCm39) probably null Het
Sorcs1 A T 19: 50,213,658 (GRCm39) C690S probably damaging Het
Spag16 T A 1: 69,962,873 (GRCm39) M340K probably benign Het
Stk3 A G 15: 35,099,611 (GRCm39) V107A probably damaging Het
Tlr1 T A 5: 65,083,653 (GRCm39) H308L probably benign Het
Tmx2 A G 2: 84,503,907 (GRCm39) F162S probably damaging Het
Vmn2r57 C T 7: 41,076,159 (GRCm39) S451N possibly damaging Het
Zbtb49 T A 5: 38,363,246 (GRCm39) I446F probably damaging Het
Zdhhc17 A T 10: 110,783,189 (GRCm39) I493N probably damaging Het
Other mutations in Dock7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dock7 APN 4 98,952,222 (GRCm39) missense probably damaging 1.00
IGL01126:Dock7 APN 4 98,861,789 (GRCm39) splice site probably benign
IGL01490:Dock7 APN 4 98,833,355 (GRCm39) unclassified probably benign
IGL01553:Dock7 APN 4 98,833,803 (GRCm39) nonsense probably null
IGL01728:Dock7 APN 4 98,850,568 (GRCm39) missense probably damaging 1.00
IGL01776:Dock7 APN 4 98,829,178 (GRCm39) missense possibly damaging 0.65
IGL01954:Dock7 APN 4 98,971,388 (GRCm39) missense probably damaging 0.99
IGL01985:Dock7 APN 4 98,911,614 (GRCm39) missense probably benign 0.35
IGL02054:Dock7 APN 4 98,861,646 (GRCm39) missense probably damaging 1.00
IGL02150:Dock7 APN 4 98,968,089 (GRCm39) splice site probably benign
IGL02153:Dock7 APN 4 98,846,304 (GRCm39) missense probably benign 0.15
IGL02183:Dock7 APN 4 98,847,228 (GRCm39) missense possibly damaging 0.89
IGL02494:Dock7 APN 4 98,877,471 (GRCm39) missense probably benign 0.18
IGL02618:Dock7 APN 4 98,971,265 (GRCm39) missense probably benign 0.00
IGL02634:Dock7 APN 4 98,877,533 (GRCm39) missense probably damaging 1.00
IGL02670:Dock7 APN 4 98,854,523 (GRCm39) splice site probably null
IGL02690:Dock7 APN 4 98,857,872 (GRCm39) missense possibly damaging 0.95
IGL02692:Dock7 APN 4 98,875,623 (GRCm39) missense probably damaging 1.00
IGL02833:Dock7 APN 4 98,833,732 (GRCm39) missense probably damaging 1.00
IGL02858:Dock7 APN 4 98,833,442 (GRCm39) nonsense probably null
IGL02875:Dock7 APN 4 98,864,231 (GRCm39) missense probably benign 0.00
IGL03027:Dock7 APN 4 98,958,450 (GRCm39) missense possibly damaging 0.71
IGL03027:Dock7 APN 4 98,866,164 (GRCm39) missense probably benign
IGL03032:Dock7 APN 4 98,854,585 (GRCm39) missense probably benign 0.02
IGL03104:Dock7 APN 4 98,847,260 (GRCm39) missense possibly damaging 0.60
IGL03136:Dock7 APN 4 98,892,028 (GRCm39) missense probably damaging 1.00
IGL03345:Dock7 APN 4 98,873,056 (GRCm39) missense possibly damaging 0.91
Beaming UTSW 4 98,967,992 (GRCm39) nonsense probably null
moonlight UTSW 4 0 () large deletion
Nocturn UTSW 4 98,952,199 (GRCm39) missense probably benign 0.00
sonata UTSW 4 98,889,364 (GRCm39) nonsense probably null
BB005:Dock7 UTSW 4 98,889,335 (GRCm39) missense
BB015:Dock7 UTSW 4 98,889,335 (GRCm39) missense
PIT4810001:Dock7 UTSW 4 98,833,796 (GRCm39) nonsense probably null
R0086:Dock7 UTSW 4 98,833,381 (GRCm39) missense probably damaging 1.00
R0242:Dock7 UTSW 4 98,850,517 (GRCm39) missense probably benign
R0242:Dock7 UTSW 4 98,850,517 (GRCm39) missense probably benign
R0245:Dock7 UTSW 4 98,943,586 (GRCm39) missense possibly damaging 0.64
R0308:Dock7 UTSW 4 98,873,051 (GRCm39) missense probably benign 0.07
R0556:Dock7 UTSW 4 98,833,426 (GRCm39) missense probably damaging 1.00
R0612:Dock7 UTSW 4 98,877,470 (GRCm39) missense probably benign 0.31
R0652:Dock7 UTSW 4 98,943,586 (GRCm39) missense possibly damaging 0.64
R0669:Dock7 UTSW 4 98,875,716 (GRCm39) missense probably benign 0.00
R0681:Dock7 UTSW 4 98,904,941 (GRCm39) missense probably damaging 1.00
R0725:Dock7 UTSW 4 98,833,528 (GRCm39) missense probably damaging 1.00
R0828:Dock7 UTSW 4 98,903,982 (GRCm39) missense probably damaging 1.00
R0837:Dock7 UTSW 4 98,877,495 (GRCm39) missense probably benign 0.01
R0962:Dock7 UTSW 4 98,833,432 (GRCm39) missense possibly damaging 0.85
R1140:Dock7 UTSW 4 98,953,643 (GRCm39) missense possibly damaging 0.82
R1476:Dock7 UTSW 4 98,967,672 (GRCm39) missense possibly damaging 0.52
R1614:Dock7 UTSW 4 98,949,517 (GRCm39) missense probably benign 0.12
R1625:Dock7 UTSW 4 98,850,433 (GRCm39) splice site probably null
R1640:Dock7 UTSW 4 98,833,483 (GRCm39) missense probably damaging 1.00
R1752:Dock7 UTSW 4 98,854,681 (GRCm39) missense probably damaging 1.00
R1941:Dock7 UTSW 4 98,872,952 (GRCm39) missense probably benign 0.09
R2020:Dock7 UTSW 4 98,847,338 (GRCm39) missense probably damaging 1.00
R2092:Dock7 UTSW 4 98,897,545 (GRCm39) missense possibly damaging 0.95
R2293:Dock7 UTSW 4 98,854,606 (GRCm39) missense probably damaging 1.00
R2424:Dock7 UTSW 4 98,833,544 (GRCm39) nonsense probably null
R3767:Dock7 UTSW 4 98,859,066 (GRCm39) missense probably benign
R3768:Dock7 UTSW 4 98,859,066 (GRCm39) missense probably benign
R3769:Dock7 UTSW 4 98,859,066 (GRCm39) missense probably benign
R3770:Dock7 UTSW 4 98,859,066 (GRCm39) missense probably benign
R3917:Dock7 UTSW 4 98,904,922 (GRCm39) missense probably damaging 1.00
R3943:Dock7 UTSW 4 98,880,668 (GRCm39) missense probably damaging 1.00
R4021:Dock7 UTSW 4 98,892,157 (GRCm39) splice site probably null
R4073:Dock7 UTSW 4 98,896,296 (GRCm39) missense probably benign 0.02
R4170:Dock7 UTSW 4 98,854,638 (GRCm39) missense probably damaging 0.99
R4180:Dock7 UTSW 4 98,904,973 (GRCm39) missense probably benign 0.05
R4261:Dock7 UTSW 4 98,892,123 (GRCm39) missense possibly damaging 0.78
R4321:Dock7 UTSW 4 98,960,691 (GRCm39) missense probably damaging 1.00
R4522:Dock7 UTSW 4 98,850,461 (GRCm39) missense probably damaging 1.00
R4582:Dock7 UTSW 4 98,892,153 (GRCm39) missense possibly damaging 0.90
R4648:Dock7 UTSW 4 98,857,881 (GRCm39) nonsense probably null
R4940:Dock7 UTSW 4 98,908,314 (GRCm39) missense probably damaging 1.00
R5090:Dock7 UTSW 4 98,879,648 (GRCm39) missense probably benign 0.04
R5374:Dock7 UTSW 4 98,877,275 (GRCm39) missense possibly damaging 0.81
R5392:Dock7 UTSW 4 98,896,243 (GRCm39) missense probably damaging 1.00
R5527:Dock7 UTSW 4 98,842,105 (GRCm39) intron probably benign
R5544:Dock7 UTSW 4 98,855,494 (GRCm39) missense probably damaging 1.00
R5556:Dock7 UTSW 4 98,832,972 (GRCm39) missense probably damaging 1.00
R5870:Dock7 UTSW 4 98,952,199 (GRCm39) missense probably benign 0.00
R5899:Dock7 UTSW 4 98,879,660 (GRCm39) missense probably benign
R6360:Dock7 UTSW 4 98,857,899 (GRCm39) missense probably benign 0.02
R6415:Dock7 UTSW 4 98,880,685 (GRCm39) missense probably damaging 1.00
R6468:Dock7 UTSW 4 98,855,464 (GRCm39) missense probably benign 0.15
R6562:Dock7 UTSW 4 98,879,647 (GRCm39) missense probably damaging 0.97
R6613:Dock7 UTSW 4 98,866,197 (GRCm39) missense probably damaging 0.99
R6703:Dock7 UTSW 4 98,834,909 (GRCm39) missense probably damaging 1.00
R6723:Dock7 UTSW 4 98,892,153 (GRCm39) missense possibly damaging 0.90
R6786:Dock7 UTSW 4 98,949,529 (GRCm39) missense probably benign 0.42
R7026:Dock7 UTSW 4 98,967,156 (GRCm39) missense probably benign
R7051:Dock7 UTSW 4 98,834,969 (GRCm39) missense probably damaging 1.00
R7074:Dock7 UTSW 4 98,833,445 (GRCm39) missense unknown
R7106:Dock7 UTSW 4 98,855,563 (GRCm39) missense unknown
R7147:Dock7 UTSW 4 98,849,654 (GRCm39) missense unknown
R7257:Dock7 UTSW 4 98,861,649 (GRCm39) missense unknown
R7334:Dock7 UTSW 4 98,864,180 (GRCm39) missense unknown
R7511:Dock7 UTSW 4 98,967,992 (GRCm39) nonsense probably null
R7511:Dock7 UTSW 4 98,949,519 (GRCm39) missense
R7729:Dock7 UTSW 4 98,943,683 (GRCm39) missense
R7928:Dock7 UTSW 4 98,889,335 (GRCm39) missense
R7984:Dock7 UTSW 4 98,877,303 (GRCm39) missense unknown
R8287:Dock7 UTSW 4 98,866,157 (GRCm39) missense unknown
R8439:Dock7 UTSW 4 98,971,266 (GRCm39) missense
R8466:Dock7 UTSW 4 98,952,336 (GRCm39) missense possibly damaging 0.70
R8758:Dock7 UTSW 4 98,949,555 (GRCm39) missense
R8849:Dock7 UTSW 4 98,904,986 (GRCm39) missense
R8944:Dock7 UTSW 4 98,829,243 (GRCm39) missense probably damaging 1.00
R8964:Dock7 UTSW 4 98,949,476 (GRCm39) missense
R9008:Dock7 UTSW 4 98,833,448 (GRCm39) nonsense probably null
R9040:Dock7 UTSW 4 98,889,364 (GRCm39) nonsense probably null
R9168:Dock7 UTSW 4 98,953,643 (GRCm39) missense
R9189:Dock7 UTSW 4 98,877,350 (GRCm39) missense unknown
R9215:Dock7 UTSW 4 98,859,088 (GRCm39) missense unknown
R9243:Dock7 UTSW 4 98,857,871 (GRCm39) missense unknown
R9256:Dock7 UTSW 4 98,971,272 (GRCm39) missense
R9328:Dock7 UTSW 4 98,968,064 (GRCm39) missense
R9332:Dock7 UTSW 4 98,896,280 (GRCm39) missense
R9450:Dock7 UTSW 4 98,861,426 (GRCm39) missense unknown
R9584:Dock7 UTSW 4 98,861,481 (GRCm39) nonsense probably null
R9631:Dock7 UTSW 4 98,854,560 (GRCm39) missense unknown
R9676:Dock7 UTSW 4 98,904,922 (GRCm39) missense probably damaging 1.00
R9701:Dock7 UTSW 4 98,846,384 (GRCm39) missense unknown
R9723:Dock7 UTSW 4 98,960,660 (GRCm39) missense
R9723:Dock7 UTSW 4 98,908,270 (GRCm39) missense
R9727:Dock7 UTSW 4 98,875,568 (GRCm39) missense unknown
R9777:Dock7 UTSW 4 98,877,464 (GRCm39) missense unknown
R9802:Dock7 UTSW 4 98,846,384 (GRCm39) missense unknown
X0027:Dock7 UTSW 4 98,892,090 (GRCm39) missense probably damaging 0.99
Z1176:Dock7 UTSW 4 98,833,462 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CACCATTGTGTGCCTCAAACTG -3'
(R):5'- AACATGCATGCCCTCAGTGG -3'

Sequencing Primer
(F):5'- ATTGTGTGCCTCAAACTGATTTC -3'
(R):5'- GATGTACAGTGAGAACCTGCCTC -3'
Posted On 2022-01-20