Incidental Mutation 'R9160:Rnf10'
ID 695636
Institutional Source Beutler Lab
Gene Symbol Rnf10
Ensembl Gene ENSMUSG00000041740
Gene Name ring finger protein 10
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.700) question?
Stock # R9160 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 115379829-115410980 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 115398249 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 95 (M95L)
Ref Sequence ENSEMBL: ENSMUSP00000107726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040555] [ENSMUST00000112096] [ENSMUST00000112097]
AlphaFold Q3UIW5
Predicted Effect probably benign
Transcript: ENSMUST00000040555
AA Change: M95L

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000041778
Gene: ENSMUSG00000041740
AA Change: M95L

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 439 461 N/A INTRINSIC
low complexity region 591 618 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112096
AA Change: M95L

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000107725
Gene: ENSMUSG00000041740
AA Change: M95L

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 439 461 N/A INTRINSIC
low complexity region 591 618 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 782 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112097
AA Change: M95L

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107726
Gene: ENSMUSG00000041740
AA Change: M95L

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 440 462 N/A INTRINSIC
low complexity region 592 619 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000131696
Gene: ENSMUSG00000041740
AA Change: M57L

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
low complexity region 63 77 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
RING 188 229 1.98e-8 SMART
low complexity region 342 363 N/A INTRINSIC
low complexity region 402 424 N/A INTRINSIC
low complexity region 554 581 N/A INTRINSIC
low complexity region 623 634 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: The protein encoding this gene is a member of the really interesting new gene finger protein family. Members of this family contain protein motifs similar to zinc finger domains and are involved in many processes that include transcriptional regulation, DNA repair and signal transduction. Expression of this gene is upregulated during neuronal differentiation of cultured cells, and inhibition of its expression impairs differentiation and cell cycle exit, providing evidence for a function in neuronal differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 G A 16: 20,379,246 (GRCm39) R704H possibly damaging Het
Akap13 T C 7: 75,385,526 (GRCm39) F533L possibly damaging Het
Ank3 G A 10: 69,838,304 (GRCm39) V1771I unknown Het
Aspm T C 1: 139,417,862 (GRCm39) L2911S probably damaging Het
Atp2b4 T C 1: 133,660,143 (GRCm39) I380V probably benign Het
C2cd3 T A 7: 100,075,236 (GRCm39) L739I Het
Cacng6 T C 7: 3,483,406 (GRCm39) S245P probably benign Het
Chd5 A G 4: 152,469,916 (GRCm39) S1830G probably damaging Het
Col20a1 T C 2: 180,641,538 (GRCm39) M660T probably benign Het
Dnajc6 G A 4: 101,470,258 (GRCm39) probably benign Het
Dock7 A G 4: 98,857,962 (GRCm39) S1451P unknown Het
Ehd4 A G 2: 119,967,440 (GRCm39) V118A probably damaging Het
Espl1 A G 15: 102,206,953 (GRCm39) D139G probably damaging Het
Fer1l6 G A 15: 58,515,715 (GRCm39) E1601K possibly damaging Het
Fermt3 A T 19: 6,991,785 (GRCm39) L142Q probably damaging Het
Gfral A T 9: 76,104,372 (GRCm39) N213K possibly damaging Het
Gria4 A G 9: 4,424,412 (GRCm39) F818L probably damaging Het
H2-Eb1 A T 17: 34,528,831 (GRCm39) R121* probably null Het
Hoxd9 A G 2: 74,529,761 (GRCm39) D339G unknown Het
Hpn G T 7: 30,808,402 (GRCm39) P78T probably benign Het
Inpp4b T A 8: 82,610,782 (GRCm39) V175E possibly damaging Het
Itpr2 A G 6: 146,276,099 (GRCm39) L736P probably damaging Het
Klhl6 G T 16: 19,775,772 (GRCm39) P262Q probably damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Mc5r A T 18: 68,472,205 (GRCm39) Y188F probably damaging Het
Mob1b T C 5: 88,904,017 (GRCm39) S218P probably benign Het
Mrgprb2 T C 7: 48,201,982 (GRCm39) I248V possibly damaging Het
Muc5ac T C 7: 141,363,529 (GRCm39) I2280T unknown Het
Or1e29 A T 11: 73,667,881 (GRCm39) S91T probably benign Het
Or2ah1 T A 2: 85,653,318 (GRCm39) M1K probably null Het
Or2o1 G T 11: 49,051,261 (GRCm39) W140L probably damaging Het
Or5j3 A T 2: 86,128,330 (GRCm39) T57S probably benign Het
Pcdhga8 T A 18: 37,860,465 (GRCm39) I507N probably damaging Het
Pkd1l2 T C 8: 117,767,408 (GRCm39) D1294G possibly damaging Het
Psg28 A G 7: 18,164,640 (GRCm39) L24P probably damaging Het
Ptk2 A T 15: 73,087,933 (GRCm39) D868E probably benign Het
Ptpn6 G C 6: 124,705,135 (GRCm39) R264G possibly damaging Het
Rnf40 C T 7: 127,190,993 (GRCm39) T326I probably damaging Het
Rp1 G T 1: 4,416,720 (GRCm39) T1464K probably benign Het
Satb1 T C 17: 52,047,053 (GRCm39) E723G probably benign Het
Scgb3a2 T A 18: 43,900,445 (GRCm39) probably benign Het
Sidt2 A G 9: 45,858,280 (GRCm39) probably null Het
Sorcs1 A T 19: 50,213,658 (GRCm39) C690S probably damaging Het
Spag16 T A 1: 69,962,873 (GRCm39) M340K probably benign Het
Stk3 A G 15: 35,099,611 (GRCm39) V107A probably damaging Het
Tlr1 T A 5: 65,083,653 (GRCm39) H308L probably benign Het
Tmx2 A G 2: 84,503,907 (GRCm39) F162S probably damaging Het
Vmn2r57 C T 7: 41,076,159 (GRCm39) S451N possibly damaging Het
Zbtb49 T A 5: 38,363,246 (GRCm39) I446F probably damaging Het
Zdhhc17 A T 10: 110,783,189 (GRCm39) I493N probably damaging Het
Other mutations in Rnf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Rnf10 APN 5 115,395,042 (GRCm39) missense probably damaging 1.00
IGL01995:Rnf10 APN 5 115,389,161 (GRCm39) nonsense probably null
IGL02291:Rnf10 APN 5 115,398,255 (GRCm39) missense probably damaging 1.00
IGL02751:Rnf10 APN 5 115,380,725 (GRCm39) missense probably benign 0.20
IGL02897:Rnf10 APN 5 115,386,700 (GRCm39) missense probably benign
IGL02968:Rnf10 APN 5 115,383,947 (GRCm39) missense probably benign 0.05
IGL03008:Rnf10 APN 5 115,389,355 (GRCm39) missense possibly damaging 0.92
IGL03098:Rnf10 UTSW 5 115,410,426 (GRCm39) missense probably damaging 1.00
R0409:Rnf10 UTSW 5 115,393,506 (GRCm39) splice site probably benign
R1083:Rnf10 UTSW 5 115,398,163 (GRCm39) splice site probably benign
R1754:Rnf10 UTSW 5 115,383,924 (GRCm39) missense probably damaging 0.99
R1957:Rnf10 UTSW 5 115,398,381 (GRCm39) splice site probably benign
R2398:Rnf10 UTSW 5 115,385,332 (GRCm39) missense probably benign 0.33
R2848:Rnf10 UTSW 5 115,387,171 (GRCm39) missense probably benign
R2849:Rnf10 UTSW 5 115,387,171 (GRCm39) missense probably benign
R4527:Rnf10 UTSW 5 115,398,210 (GRCm39) missense probably damaging 0.96
R4617:Rnf10 UTSW 5 115,386,762 (GRCm39) missense probably damaging 1.00
R4673:Rnf10 UTSW 5 115,389,148 (GRCm39) missense probably damaging 0.99
R4823:Rnf10 UTSW 5 115,393,501 (GRCm39) critical splice acceptor site probably null
R5560:Rnf10 UTSW 5 115,388,057 (GRCm39) missense probably damaging 1.00
R5805:Rnf10 UTSW 5 115,382,127 (GRCm39) missense probably benign
R6192:Rnf10 UTSW 5 115,395,136 (GRCm39) missense probably damaging 1.00
R7061:Rnf10 UTSW 5 115,395,149 (GRCm39) missense probably damaging 0.98
R7206:Rnf10 UTSW 5 115,382,180 (GRCm39) missense probably benign 0.04
R7213:Rnf10 UTSW 5 115,380,533 (GRCm39) missense probably damaging 1.00
R7213:Rnf10 UTSW 5 115,380,532 (GRCm39) missense probably damaging 1.00
R7429:Rnf10 UTSW 5 115,386,739 (GRCm39) missense probably damaging 1.00
R8098:Rnf10 UTSW 5 115,389,438 (GRCm39) missense probably damaging 0.98
R8179:Rnf10 UTSW 5 115,398,176 (GRCm39) frame shift probably null
R8252:Rnf10 UTSW 5 115,398,373 (GRCm39) missense probably benign 0.03
R8357:Rnf10 UTSW 5 115,410,320 (GRCm39) missense possibly damaging 0.54
R8457:Rnf10 UTSW 5 115,410,320 (GRCm39) missense possibly damaging 0.54
R9274:Rnf10 UTSW 5 115,385,322 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACACACCTGCTGTCATGTC -3'
(R):5'- AGAAATTGGCCGTGTCTGG -3'

Sequencing Primer
(F):5'- TGTCACAGACCCCCAGG -3'
(R):5'- ATTGGCCGTGTCTGGGAAAAC -3'
Posted On 2022-01-20