Incidental Mutation 'R9160:Akap13'
ID 695644
Institutional Source Beutler Lab
Gene Symbol Akap13
Ensembl Gene ENSMUSG00000066406
Gene Name A kinase anchor protein 13
Synonyms PROTO-LB, Ht31, 5830460E08Rik, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, AKAP-Lbc
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9160 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 75105282-75404357 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75385526 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 533 (F533L)
Ref Sequence ENSEMBL: ENSMUSP00000146401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207239] [ENSMUST00000207750]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000166315
AA Change: F2234L

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406
AA Change: F2234L

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
low complexity region 1433 1448 N/A INTRINSIC
low complexity region 1483 1505 N/A INTRINSIC
low complexity region 1583 1594 N/A INTRINSIC
low complexity region 1720 1750 N/A INTRINSIC
C1 1755 1801 1.95e-4 SMART
low complexity region 1858 1869 N/A INTRINSIC
RhoGEF 1961 2153 1.28e-61 SMART
PH 2195 2298 2.94e-11 SMART
coiled coil region 2308 2345 N/A INTRINSIC
low complexity region 2393 2412 N/A INTRINSIC
low complexity region 2444 2454 N/A INTRINSIC
coiled coil region 2533 2646 N/A INTRINSIC
low complexity region 2728 2734 N/A INTRINSIC
low complexity region 2740 2753 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000207239
AA Change: F533L

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000207750
AA Change: F2252L

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.1443 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 G A 16: 20,379,246 (GRCm39) R704H possibly damaging Het
Ank3 G A 10: 69,838,304 (GRCm39) V1771I unknown Het
Aspm T C 1: 139,417,862 (GRCm39) L2911S probably damaging Het
Atp2b4 T C 1: 133,660,143 (GRCm39) I380V probably benign Het
C2cd3 T A 7: 100,075,236 (GRCm39) L739I Het
Cacng6 T C 7: 3,483,406 (GRCm39) S245P probably benign Het
Chd5 A G 4: 152,469,916 (GRCm39) S1830G probably damaging Het
Col20a1 T C 2: 180,641,538 (GRCm39) M660T probably benign Het
Dnajc6 G A 4: 101,470,258 (GRCm39) probably benign Het
Dock7 A G 4: 98,857,962 (GRCm39) S1451P unknown Het
Ehd4 A G 2: 119,967,440 (GRCm39) V118A probably damaging Het
Espl1 A G 15: 102,206,953 (GRCm39) D139G probably damaging Het
Fer1l6 G A 15: 58,515,715 (GRCm39) E1601K possibly damaging Het
Fermt3 A T 19: 6,991,785 (GRCm39) L142Q probably damaging Het
Gfral A T 9: 76,104,372 (GRCm39) N213K possibly damaging Het
Gria4 A G 9: 4,424,412 (GRCm39) F818L probably damaging Het
H2-Eb1 A T 17: 34,528,831 (GRCm39) R121* probably null Het
Hoxd9 A G 2: 74,529,761 (GRCm39) D339G unknown Het
Hpn G T 7: 30,808,402 (GRCm39) P78T probably benign Het
Inpp4b T A 8: 82,610,782 (GRCm39) V175E possibly damaging Het
Itpr2 A G 6: 146,276,099 (GRCm39) L736P probably damaging Het
Klhl6 G T 16: 19,775,772 (GRCm39) P262Q probably damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Mc5r A T 18: 68,472,205 (GRCm39) Y188F probably damaging Het
Mob1b T C 5: 88,904,017 (GRCm39) S218P probably benign Het
Mrgprb2 T C 7: 48,201,982 (GRCm39) I248V possibly damaging Het
Muc5ac T C 7: 141,363,529 (GRCm39) I2280T unknown Het
Or1e29 A T 11: 73,667,881 (GRCm39) S91T probably benign Het
Or2ah1 T A 2: 85,653,318 (GRCm39) M1K probably null Het
Or2o1 G T 11: 49,051,261 (GRCm39) W140L probably damaging Het
Or5j3 A T 2: 86,128,330 (GRCm39) T57S probably benign Het
Pcdhga8 T A 18: 37,860,465 (GRCm39) I507N probably damaging Het
Pkd1l2 T C 8: 117,767,408 (GRCm39) D1294G possibly damaging Het
Psg28 A G 7: 18,164,640 (GRCm39) L24P probably damaging Het
Ptk2 A T 15: 73,087,933 (GRCm39) D868E probably benign Het
Ptpn6 G C 6: 124,705,135 (GRCm39) R264G possibly damaging Het
Rnf10 T A 5: 115,398,249 (GRCm39) M95L probably benign Het
Rnf40 C T 7: 127,190,993 (GRCm39) T326I probably damaging Het
Rp1 G T 1: 4,416,720 (GRCm39) T1464K probably benign Het
Satb1 T C 17: 52,047,053 (GRCm39) E723G probably benign Het
Scgb3a2 T A 18: 43,900,445 (GRCm39) probably benign Het
Sidt2 A G 9: 45,858,280 (GRCm39) probably null Het
Sorcs1 A T 19: 50,213,658 (GRCm39) C690S probably damaging Het
Spag16 T A 1: 69,962,873 (GRCm39) M340K probably benign Het
Stk3 A G 15: 35,099,611 (GRCm39) V107A probably damaging Het
Tlr1 T A 5: 65,083,653 (GRCm39) H308L probably benign Het
Tmx2 A G 2: 84,503,907 (GRCm39) F162S probably damaging Het
Vmn2r57 C T 7: 41,076,159 (GRCm39) S451N possibly damaging Het
Zbtb49 T A 5: 38,363,246 (GRCm39) I446F probably damaging Het
Zdhhc17 A T 10: 110,783,189 (GRCm39) I493N probably damaging Het
Other mutations in Akap13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Akap13 APN 7 75,375,719 (GRCm39) missense probably damaging 0.99
IGL00332:Akap13 APN 7 75,378,667 (GRCm39) missense probably damaging 1.00
IGL00481:Akap13 APN 7 75,373,643 (GRCm39) missense probably damaging 1.00
IGL00590:Akap13 APN 7 75,260,417 (GRCm39) missense probably benign 0.01
IGL00655:Akap13 APN 7 75,354,146 (GRCm39) missense probably damaging 0.99
IGL00766:Akap13 APN 7 75,354,260 (GRCm39) missense probably damaging 0.96
IGL00818:Akap13 APN 7 75,259,475 (GRCm39) missense probably benign 0.00
IGL00826:Akap13 APN 7 75,327,195 (GRCm39) missense probably damaging 1.00
IGL01014:Akap13 APN 7 75,400,381 (GRCm39) utr 3 prime probably benign
IGL01090:Akap13 APN 7 75,316,279 (GRCm39) missense probably benign 0.44
IGL01155:Akap13 APN 7 75,219,684 (GRCm39) missense probably damaging 1.00
IGL01326:Akap13 APN 7 75,375,096 (GRCm39) missense probably benign 0.30
IGL01456:Akap13 APN 7 75,252,595 (GRCm39) missense probably damaging 0.98
IGL01460:Akap13 APN 7 75,397,594 (GRCm39) missense probably benign 0.29
IGL01568:Akap13 APN 7 75,258,270 (GRCm39) nonsense probably null 0.00
IGL01610:Akap13 APN 7 75,397,353 (GRCm39) missense probably damaging 1.00
IGL01610:Akap13 APN 7 75,369,928 (GRCm39) missense possibly damaging 0.71
IGL01615:Akap13 APN 7 75,347,141 (GRCm39) missense probably damaging 1.00
IGL01667:Akap13 APN 7 75,219,767 (GRCm39) missense probably damaging 1.00
IGL01705:Akap13 APN 7 75,396,515 (GRCm39) missense possibly damaging 0.86
IGL02070:Akap13 APN 7 75,316,293 (GRCm39) missense probably benign 0.27
IGL02269:Akap13 APN 7 75,252,659 (GRCm39) missense probably benign
IGL02421:Akap13 APN 7 75,367,554 (GRCm39) missense possibly damaging 0.66
IGL02870:Akap13 APN 7 75,258,936 (GRCm39) missense probably damaging 0.96
IGL02944:Akap13 APN 7 75,258,405 (GRCm39) missense probably benign
IGL03051:Akap13 APN 7 75,260,233 (GRCm39) nonsense probably null
IGL03160:Akap13 APN 7 75,380,165 (GRCm39) missense probably damaging 1.00
IGL03245:Akap13 APN 7 75,259,500 (GRCm39) missense probably damaging 0.99
R0254:Akap13 UTSW 7 75,386,352 (GRCm39) splice site probably benign
R0310:Akap13 UTSW 7 75,264,678 (GRCm39) missense probably damaging 0.99
R0373:Akap13 UTSW 7 75,380,248 (GRCm39) missense probably damaging 1.00
R0373:Akap13 UTSW 7 75,259,677 (GRCm39) missense probably benign 0.00
R0408:Akap13 UTSW 7 75,396,544 (GRCm39) missense probably damaging 1.00
R0631:Akap13 UTSW 7 75,264,744 (GRCm39) missense probably damaging 0.99
R0646:Akap13 UTSW 7 75,397,494 (GRCm39) missense probably damaging 1.00
R0781:Akap13 UTSW 7 75,261,125 (GRCm39) missense possibly damaging 0.56
R0845:Akap13 UTSW 7 75,375,128 (GRCm39) missense probably damaging 1.00
R1004:Akap13 UTSW 7 75,337,034 (GRCm39) missense probably damaging 0.99
R1024:Akap13 UTSW 7 75,327,157 (GRCm39) missense probably damaging 1.00
R1110:Akap13 UTSW 7 75,261,125 (GRCm39) missense possibly damaging 0.56
R1346:Akap13 UTSW 7 75,259,340 (GRCm39) missense possibly damaging 0.67
R1349:Akap13 UTSW 7 75,259,340 (GRCm39) missense possibly damaging 0.67
R1372:Akap13 UTSW 7 75,259,340 (GRCm39) missense possibly damaging 0.67
R1387:Akap13 UTSW 7 75,235,941 (GRCm39) missense probably damaging 0.97
R1442:Akap13 UTSW 7 75,385,526 (GRCm39) missense probably damaging 0.99
R1466:Akap13 UTSW 7 75,378,797 (GRCm39) missense possibly damaging 0.79
R1466:Akap13 UTSW 7 75,378,797 (GRCm39) missense possibly damaging 0.79
R1584:Akap13 UTSW 7 75,378,797 (GRCm39) missense possibly damaging 0.79
R1696:Akap13 UTSW 7 75,259,340 (GRCm39) missense possibly damaging 0.67
R1738:Akap13 UTSW 7 75,326,942 (GRCm39) missense probably damaging 1.00
R1773:Akap13 UTSW 7 75,333,199 (GRCm39) missense possibly damaging 0.80
R1785:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R1786:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R1791:Akap13 UTSW 7 75,260,783 (GRCm39) missense probably benign 0.00
R1819:Akap13 UTSW 7 75,258,453 (GRCm39) missense probably benign 0.04
R1879:Akap13 UTSW 7 75,260,475 (GRCm39) missense probably benign 0.01
R1989:Akap13 UTSW 7 75,354,264 (GRCm39) missense probably benign 0.01
R2016:Akap13 UTSW 7 75,354,279 (GRCm39) missense probably damaging 0.99
R2092:Akap13 UTSW 7 75,260,318 (GRCm39) missense probably benign 0.05
R2126:Akap13 UTSW 7 75,375,052 (GRCm39) missense possibly damaging 0.95
R2131:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R2132:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R2133:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R2251:Akap13 UTSW 7 75,389,225 (GRCm39) missense possibly damaging 0.50
R3704:Akap13 UTSW 7 75,316,298 (GRCm39) missense probably damaging 1.00
R3713:Akap13 UTSW 7 75,235,929 (GRCm39) missense probably damaging 0.98
R3731:Akap13 UTSW 7 75,261,125 (GRCm39) missense probably benign 0.39
R3765:Akap13 UTSW 7 75,258,585 (GRCm39) missense probably benign 0.04
R3788:Akap13 UTSW 7 75,351,901 (GRCm39) critical splice donor site probably null
R3793:Akap13 UTSW 7 75,259,889 (GRCm39) missense probably benign 0.00
R3970:Akap13 UTSW 7 75,219,699 (GRCm39) nonsense probably null
R4205:Akap13 UTSW 7 75,260,667 (GRCm39) missense probably benign 0.05
R4257:Akap13 UTSW 7 75,261,033 (GRCm39) missense probably damaging 0.98
R4374:Akap13 UTSW 7 75,258,732 (GRCm39) missense probably damaging 0.96
R4448:Akap13 UTSW 7 75,392,508 (GRCm39) missense probably damaging 1.00
R4450:Akap13 UTSW 7 75,392,508 (GRCm39) missense probably damaging 1.00
R4457:Akap13 UTSW 7 75,389,213 (GRCm39) missense probably damaging 0.99
R4458:Akap13 UTSW 7 75,389,213 (GRCm39) missense probably damaging 0.99
R4466:Akap13 UTSW 7 75,252,521 (GRCm39) splice site probably null
R4632:Akap13 UTSW 7 75,316,301 (GRCm39) missense possibly damaging 0.91
R4667:Akap13 UTSW 7 75,378,842 (GRCm39) missense probably damaging 1.00
R4669:Akap13 UTSW 7 75,378,842 (GRCm39) missense probably damaging 1.00
R4671:Akap13 UTSW 7 75,229,312 (GRCm39) nonsense probably null
R4821:Akap13 UTSW 7 75,327,255 (GRCm39) intron probably benign
R4868:Akap13 UTSW 7 75,393,252 (GRCm39) missense probably damaging 1.00
R4894:Akap13 UTSW 7 75,375,068 (GRCm39) missense possibly damaging 0.76
R4943:Akap13 UTSW 7 75,398,988 (GRCm39) missense probably benign 0.22
R4962:Akap13 UTSW 7 75,399,178 (GRCm39) missense probably damaging 0.98
R4988:Akap13 UTSW 7 75,380,276 (GRCm39) missense probably damaging 1.00
R5119:Akap13 UTSW 7 75,337,000 (GRCm39) missense probably damaging 0.98
R5141:Akap13 UTSW 7 75,259,362 (GRCm39) missense probably benign 0.18
R5419:Akap13 UTSW 7 75,259,991 (GRCm39) missense probably benign 0.01
R5427:Akap13 UTSW 7 75,378,617 (GRCm39) missense possibly damaging 0.89
R5429:Akap13 UTSW 7 75,252,652 (GRCm39) missense possibly damaging 0.70
R5432:Akap13 UTSW 7 75,252,578 (GRCm39) missense probably damaging 1.00
R5458:Akap13 UTSW 7 75,236,049 (GRCm39) missense probably damaging 1.00
R5636:Akap13 UTSW 7 75,354,120 (GRCm39) missense probably damaging 0.96
R5643:Akap13 UTSW 7 75,351,902 (GRCm39) critical splice donor site probably null
R5898:Akap13 UTSW 7 75,378,894 (GRCm39) missense probably damaging 1.00
R5932:Akap13 UTSW 7 75,259,932 (GRCm39) missense probably damaging 1.00
R6135:Akap13 UTSW 7 75,259,656 (GRCm39) missense possibly damaging 0.94
R6137:Akap13 UTSW 7 75,327,164 (GRCm39) missense probably damaging 1.00
R6182:Akap13 UTSW 7 75,236,028 (GRCm39) missense probably benign 0.45
R6310:Akap13 UTSW 7 75,398,941 (GRCm39) missense probably damaging 0.99
R6346:Akap13 UTSW 7 75,335,002 (GRCm39) missense probably damaging 1.00
R6466:Akap13 UTSW 7 75,376,792 (GRCm39) missense probably benign 0.01
R6605:Akap13 UTSW 7 75,229,516 (GRCm39) missense probably damaging 0.98
R6617:Akap13 UTSW 7 75,380,111 (GRCm39) missense possibly damaging 0.95
R6621:Akap13 UTSW 7 75,219,729 (GRCm39) missense probably damaging 1.00
R6703:Akap13 UTSW 7 75,252,646 (GRCm39) missense probably damaging 1.00
R6750:Akap13 UTSW 7 75,389,206 (GRCm39) missense probably benign 0.03
R7069:Akap13 UTSW 7 75,260,010 (GRCm39) missense probably benign 0.29
R7116:Akap13 UTSW 7 75,369,943 (GRCm39) missense probably benign 0.00
R7158:Akap13 UTSW 7 75,229,342 (GRCm39) missense probably damaging 0.97
R7159:Akap13 UTSW 7 75,380,327 (GRCm39) missense possibly damaging 0.72
R7467:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7468:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7471:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7472:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7477:Akap13 UTSW 7 75,398,995 (GRCm39) missense probably benign
R7636:Akap13 UTSW 7 75,259,621 (GRCm39) missense probably benign 0.04
R7650:Akap13 UTSW 7 75,293,202 (GRCm39) missense probably benign 0.20
R7671:Akap13 UTSW 7 75,219,648 (GRCm39) missense probably damaging 1.00
R7681:Akap13 UTSW 7 75,378,544 (GRCm39) missense possibly damaging 0.91
R7752:Akap13 UTSW 7 75,327,006 (GRCm39) missense possibly damaging 0.74
R7784:Akap13 UTSW 7 75,260,076 (GRCm39) missense probably benign 0.00
R7816:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7817:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7834:Akap13 UTSW 7 75,392,390 (GRCm39) missense possibly damaging 0.85
R7880:Akap13 UTSW 7 75,235,964 (GRCm39) missense probably damaging 0.97
R7942:Akap13 UTSW 7 75,261,218 (GRCm39) missense possibly damaging 0.50
R8006:Akap13 UTSW 7 75,229,444 (GRCm39) missense probably damaging 1.00
R8009:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8011:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8012:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8013:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8016:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8089:Akap13 UTSW 7 75,260,340 (GRCm39) missense possibly damaging 0.94
R8138:Akap13 UTSW 7 75,351,979 (GRCm39) splice site probably null
R8174:Akap13 UTSW 7 75,378,617 (GRCm39) missense possibly damaging 0.89
R8298:Akap13 UTSW 7 75,397,552 (GRCm39) missense probably damaging 1.00
R8444:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8445:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8465:Akap13 UTSW 7 75,376,786 (GRCm39) missense probably benign 0.11
R8512:Akap13 UTSW 7 75,260,834 (GRCm39) missense probably damaging 0.99
R8523:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8793:Akap13 UTSW 7 75,375,076 (GRCm39) missense probably benign 0.35
R8907:Akap13 UTSW 7 75,260,456 (GRCm39) missense probably damaging 0.99
R8907:Akap13 UTSW 7 75,260,444 (GRCm39) missense probably benign 0.08
R8928:Akap13 UTSW 7 75,259,606 (GRCm39) missense probably benign 0.00
R8929:Akap13 UTSW 7 75,258,752 (GRCm39) missense probably benign 0.00
R8937:Akap13 UTSW 7 75,184,601 (GRCm39) critical splice donor site probably null
R8967:Akap13 UTSW 7 75,378,882 (GRCm39) missense possibly damaging 0.80
R8986:Akap13 UTSW 7 75,259,074 (GRCm39) missense probably benign
R9152:Akap13 UTSW 7 75,261,033 (GRCm39) missense probably damaging 0.98
R9153:Akap13 UTSW 7 75,259,229 (GRCm39) missense probably benign 0.00
R9192:Akap13 UTSW 7 75,354,249 (GRCm39) missense probably benign 0.06
R9319:Akap13 UTSW 7 75,258,836 (GRCm39) missense probably benign 0.01
R9513:Akap13 UTSW 7 75,354,275 (GRCm39) missense probably benign 0.01
R9515:Akap13 UTSW 7 75,354,275 (GRCm39) missense probably benign 0.01
R9516:Akap13 UTSW 7 75,354,275 (GRCm39) missense probably benign 0.01
R9523:Akap13 UTSW 7 75,293,193 (GRCm39) missense
R9564:Akap13 UTSW 7 75,259,161 (GRCm39) missense probably benign
R9621:Akap13 UTSW 7 75,386,090 (GRCm39) missense probably benign 0.09
R9686:Akap13 UTSW 7 75,236,084 (GRCm39) missense probably damaging 1.00
Z1176:Akap13 UTSW 7 75,380,300 (GRCm39) missense probably damaging 0.99
Z1177:Akap13 UTSW 7 75,264,753 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GAAGCTACAGGTGACACATCG -3'
(R):5'- GAAATTATTCAGAGGAGTCACCTG -3'

Sequencing Primer
(F):5'- GCTACAGGTGACACATCGATTTAC -3'
(R):5'- CACCTGATAGGAGTCAAGTGGTTTTC -3'
Posted On 2022-01-20