Incidental Mutation 'R9160:Or2o1'
ID 695655
Institutional Source Beutler Lab
Gene Symbol Or2o1
Ensembl Gene ENSMUSG00000048378
Gene Name olfactory receptor family 2 subfamily O member 1
Synonyms MOR280-1, Olfr1394, GA_x6K02T2QP88-6274566-6273628
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R9160 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 49050843-49051781 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 49051261 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Leucine at position 140 (W140L)
Ref Sequence ENSEMBL: ENSMUSP00000149520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052668] [ENSMUST00000216273]
AlphaFold Q8VET2
Predicted Effect probably damaging
Transcript: ENSMUST00000052668
AA Change: W140L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063062
Gene: ENSMUSG00000048378
AA Change: W140L

DomainStartEndE-ValueType
Pfam:7tm_4 30 309 6.5e-53 PFAM
Pfam:7TM_GPCR_Srsx 37 233 3e-5 PFAM
Pfam:7tm_1 43 292 2.1e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216273
AA Change: W140L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 G A 16: 20,379,246 (GRCm39) R704H possibly damaging Het
Akap13 T C 7: 75,385,526 (GRCm39) F533L possibly damaging Het
Ank3 G A 10: 69,838,304 (GRCm39) V1771I unknown Het
Aspm T C 1: 139,417,862 (GRCm39) L2911S probably damaging Het
Atp2b4 T C 1: 133,660,143 (GRCm39) I380V probably benign Het
C2cd3 T A 7: 100,075,236 (GRCm39) L739I Het
Cacng6 T C 7: 3,483,406 (GRCm39) S245P probably benign Het
Chd5 A G 4: 152,469,916 (GRCm39) S1830G probably damaging Het
Col20a1 T C 2: 180,641,538 (GRCm39) M660T probably benign Het
Dnajc6 G A 4: 101,470,258 (GRCm39) probably benign Het
Dock7 A G 4: 98,857,962 (GRCm39) S1451P unknown Het
Ehd4 A G 2: 119,967,440 (GRCm39) V118A probably damaging Het
Espl1 A G 15: 102,206,953 (GRCm39) D139G probably damaging Het
Fer1l6 G A 15: 58,515,715 (GRCm39) E1601K possibly damaging Het
Fermt3 A T 19: 6,991,785 (GRCm39) L142Q probably damaging Het
Gfral A T 9: 76,104,372 (GRCm39) N213K possibly damaging Het
Gria4 A G 9: 4,424,412 (GRCm39) F818L probably damaging Het
H2-Eb1 A T 17: 34,528,831 (GRCm39) R121* probably null Het
Hoxd9 A G 2: 74,529,761 (GRCm39) D339G unknown Het
Hpn G T 7: 30,808,402 (GRCm39) P78T probably benign Het
Inpp4b T A 8: 82,610,782 (GRCm39) V175E possibly damaging Het
Itpr2 A G 6: 146,276,099 (GRCm39) L736P probably damaging Het
Klhl6 G T 16: 19,775,772 (GRCm39) P262Q probably damaging Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Mc5r A T 18: 68,472,205 (GRCm39) Y188F probably damaging Het
Mob1b T C 5: 88,904,017 (GRCm39) S218P probably benign Het
Mrgprb2 T C 7: 48,201,982 (GRCm39) I248V possibly damaging Het
Muc5ac T C 7: 141,363,529 (GRCm39) I2280T unknown Het
Or1e29 A T 11: 73,667,881 (GRCm39) S91T probably benign Het
Or2ah1 T A 2: 85,653,318 (GRCm39) M1K probably null Het
Or5j3 A T 2: 86,128,330 (GRCm39) T57S probably benign Het
Pcdhga8 T A 18: 37,860,465 (GRCm39) I507N probably damaging Het
Pkd1l2 T C 8: 117,767,408 (GRCm39) D1294G possibly damaging Het
Psg28 A G 7: 18,164,640 (GRCm39) L24P probably damaging Het
Ptk2 A T 15: 73,087,933 (GRCm39) D868E probably benign Het
Ptpn6 G C 6: 124,705,135 (GRCm39) R264G possibly damaging Het
Rnf10 T A 5: 115,398,249 (GRCm39) M95L probably benign Het
Rnf40 C T 7: 127,190,993 (GRCm39) T326I probably damaging Het
Rp1 G T 1: 4,416,720 (GRCm39) T1464K probably benign Het
Satb1 T C 17: 52,047,053 (GRCm39) E723G probably benign Het
Scgb3a2 T A 18: 43,900,445 (GRCm39) probably benign Het
Sidt2 A G 9: 45,858,280 (GRCm39) probably null Het
Sorcs1 A T 19: 50,213,658 (GRCm39) C690S probably damaging Het
Spag16 T A 1: 69,962,873 (GRCm39) M340K probably benign Het
Stk3 A G 15: 35,099,611 (GRCm39) V107A probably damaging Het
Tlr1 T A 5: 65,083,653 (GRCm39) H308L probably benign Het
Tmx2 A G 2: 84,503,907 (GRCm39) F162S probably damaging Het
Vmn2r57 C T 7: 41,076,159 (GRCm39) S451N possibly damaging Het
Zbtb49 T A 5: 38,363,246 (GRCm39) I446F probably damaging Het
Zdhhc17 A T 10: 110,783,189 (GRCm39) I493N probably damaging Het
Other mutations in Or2o1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Or2o1 APN 11 49,051,501 (GRCm39) missense probably damaging 1.00
IGL01603:Or2o1 APN 11 49,051,438 (GRCm39) missense probably damaging 1.00
IGL01736:Or2o1 APN 11 49,051,354 (GRCm39) missense probably damaging 1.00
IGL02246:Or2o1 APN 11 49,050,921 (GRCm39) missense probably benign 0.44
IGL02321:Or2o1 APN 11 49,051,602 (GRCm39) missense probably damaging 1.00
IGL03405:Or2o1 APN 11 49,051,713 (GRCm39) splice site probably null
R0358:Or2o1 UTSW 11 49,051,071 (GRCm39) missense probably benign 0.00
R1967:Or2o1 UTSW 11 49,051,675 (GRCm39) missense probably benign 0.06
R2472:Or2o1 UTSW 11 49,051,198 (GRCm39) missense possibly damaging 0.76
R3824:Or2o1 UTSW 11 49,051,620 (GRCm39) missense possibly damaging 0.48
R4105:Or2o1 UTSW 11 49,051,375 (GRCm39) missense possibly damaging 0.51
R4255:Or2o1 UTSW 11 49,051,262 (GRCm39) nonsense probably null
R4716:Or2o1 UTSW 11 49,051,717 (GRCm39) missense probably damaging 1.00
R5545:Or2o1 UTSW 11 49,051,453 (GRCm39) missense probably damaging 1.00
R6894:Or2o1 UTSW 11 49,051,186 (GRCm39) missense probably benign 0.06
R6999:Or2o1 UTSW 11 49,051,239 (GRCm39) missense possibly damaging 0.53
R8077:Or2o1 UTSW 11 49,051,312 (GRCm39) missense probably damaging 1.00
R8266:Or2o1 UTSW 11 49,051,352 (GRCm39) nonsense probably null
R8387:Or2o1 UTSW 11 49,051,497 (GRCm39) missense probably damaging 1.00
R8712:Or2o1 UTSW 11 49,051,297 (GRCm39) missense probably benign 0.39
R9542:Or2o1 UTSW 11 49,051,073 (GRCm39) nonsense probably null
Z1177:Or2o1 UTSW 11 49,051,692 (GRCm39) frame shift probably null
Z1177:Or2o1 UTSW 11 49,051,125 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ACAGTGGTACCCAAGATGGC -3'
(R):5'- GAGGCAGCAGTAACATCACC -3'

Sequencing Primer
(F):5'- GATGGCAACCAACTTTCTCTCAGG -3'
(R):5'- AACATGCATAGATGAGGTCCTC -3'
Posted On 2022-01-20