Incidental Mutation 'R9160:Stk3'
ID 695658
Institutional Source Beutler Lab
Gene Symbol Stk3
Ensembl Gene ENSMUSG00000022329
Gene Name serine/threonine kinase 3
Synonyms mess1, MST, Mst2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9160 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 34875496-35178921 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 35099465 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 107 (V107A)
Ref Sequence ENSEMBL: ENSMUSP00000018476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018476] [ENSMUST00000067033] [ENSMUST00000138841] [ENSMUST00000226555]
AlphaFold Q9JI10
Predicted Effect probably damaging
Transcript: ENSMUST00000018476
AA Change: V107A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000018476
Gene: ENSMUSG00000022329
AA Change: V107A

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
S_TKc 27 278 4.16e-103 SMART
low complexity region 301 324 N/A INTRINSIC
low complexity region 370 381 N/A INTRINSIC
Pfam:Mst1_SARAH 443 490 9.6e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000067033
AA Change: V37A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064225
Gene: ENSMUSG00000022329
AA Change: V37A

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 5 205 2.1e-41 PFAM
Pfam:Pkinase 5 208 1.2e-56 PFAM
coiled coil region 217 256 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
Pfam:Mst1_SARAH 372 420 9.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138841
Predicted Effect probably damaging
Transcript: ENSMUST00000226555
AA Change: V105A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase activated by proapoptotic molecules indicating the encoded protein functions as a growth suppressor. Cleavage of the protein product by caspase removes the inhibitory C-terminal portion. The N-terminal portion is transported to the nucleus where it homodimerizes to form the active kinase which promotes the condensation of chromatin during apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous inactivation of this gene generally results in mice that are viable, fertile and developmentally normal. A small subset of mice homozygous for a knock-out allele develop mammary tumors in the absence of immunological defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 G A 16: 20,560,496 R704H possibly damaging Het
Akap13 T C 7: 75,735,778 F533L possibly damaging Het
Ank3 G A 10: 70,002,474 V1771I unknown Het
Aspm T C 1: 139,490,124 L2911S probably damaging Het
Atp2b4 T C 1: 133,732,405 I380V probably benign Het
C2cd3 T A 7: 100,426,029 L739I Het
Cacng6 T C 7: 3,434,890 S245P probably benign Het
Chd5 A G 4: 152,385,459 S1830G probably damaging Het
Col20a1 T C 2: 180,999,745 M660T probably benign Het
Dnajc6 G A 4: 101,613,061 probably benign Het
Dock7 A G 4: 98,969,725 S1451P unknown Het
Ehd4 A G 2: 120,136,959 V118A probably damaging Het
Espl1 A G 15: 102,298,518 D139G probably damaging Het
Fer1l6 G A 15: 58,643,866 E1601K possibly damaging Het
Fermt3 A T 19: 7,014,417 L142Q probably damaging Het
Gfral A T 9: 76,197,090 N213K possibly damaging Het
Gria4 A G 9: 4,424,412 F818L probably damaging Het
H2-Eb1 A T 17: 34,309,857 R121* probably null Het
Hoxd9 A G 2: 74,699,417 D339G unknown Het
Hpn G T 7: 31,108,977 P78T probably benign Het
Inpp4b T A 8: 81,884,153 V175E possibly damaging Het
Itpr2 A G 6: 146,374,601 L736P probably damaging Het
Klhl6 G T 16: 19,957,022 P262Q probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mc5r A T 18: 68,339,134 Y188F probably damaging Het
Mob1b T C 5: 88,756,158 S218P probably benign Het
Mrgprb2 T C 7: 48,552,234 I248V possibly damaging Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Olfr1018 T A 2: 85,822,974 M1K probably null Het
Olfr1052 A T 2: 86,297,986 T57S probably benign Het
Olfr1394 G T 11: 49,160,434 W140L probably damaging Het
Olfr389 A T 11: 73,777,055 S91T probably benign Het
Pcdhga8 T A 18: 37,727,412 I507N probably damaging Het
Pkd1l2 T C 8: 117,040,669 D1294G possibly damaging Het
Psg28 A G 7: 18,430,715 L24P probably damaging Het
Ptk2 A T 15: 73,216,084 D868E probably benign Het
Ptpn6 G C 6: 124,728,172 R264G possibly damaging Het
Rnf10 T A 5: 115,260,190 M95L probably benign Het
Rnf40 C T 7: 127,591,821 T326I probably damaging Het
Rp1 G T 1: 4,346,497 T1464K probably benign Het
Satb1 T C 17: 51,740,025 E723G probably benign Het
Scgb3a2 T A 18: 43,767,380 probably benign Het
Sidt2 A G 9: 45,946,982 probably null Het
Sorcs1 A T 19: 50,225,220 C690S probably damaging Het
Spag16 T A 1: 69,923,714 M340K probably benign Het
Tlr1 T A 5: 64,926,310 H308L probably benign Het
Tmx2 A G 2: 84,673,563 F162S probably damaging Het
Vmn2r57 C T 7: 41,426,735 S451N possibly damaging Het
Zbtb49 T A 5: 38,205,902 I446F probably damaging Het
Zdhhc17 A T 10: 110,947,328 I493N probably damaging Het
Other mutations in Stk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Stk3 APN 15 35114622 missense possibly damaging 0.93
IGL02133:Stk3 APN 15 35099516 missense probably damaging 1.00
IGL03121:Stk3 APN 15 35099426 splice site probably benign
IGL03309:Stk3 APN 15 35099551 splice site probably benign
R0276:Stk3 UTSW 15 35099469 missense probably damaging 1.00
R0416:Stk3 UTSW 15 35114632 missense probably benign 0.07
R1352:Stk3 UTSW 15 35008225 missense probably damaging 1.00
R1633:Stk3 UTSW 15 34959060 missense probably damaging 1.00
R1638:Stk3 UTSW 15 35008308 splice site probably null
R1917:Stk3 UTSW 15 35073217 missense probably damaging 1.00
R1919:Stk3 UTSW 15 35073217 missense probably damaging 1.00
R2011:Stk3 UTSW 15 35072498 missense probably damaging 1.00
R2072:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R2073:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R2075:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R3158:Stk3 UTSW 15 35008241 missense possibly damaging 0.83
R3402:Stk3 UTSW 15 34944998 splice site probably benign
R4633:Stk3 UTSW 15 34958928 missense probably damaging 0.99
R4672:Stk3 UTSW 15 35099457 missense probably benign 0.06
R4687:Stk3 UTSW 15 35114565 missense probably damaging 0.99
R4825:Stk3 UTSW 15 34999908 missense probably benign 0.14
R4903:Stk3 UTSW 15 34959066 missense probably damaging 0.99
R5390:Stk3 UTSW 15 35114560 nonsense probably null
R5834:Stk3 UTSW 15 34959018 missense probably damaging 1.00
R7208:Stk3 UTSW 15 35073116 missense possibly damaging 0.76
R7266:Stk3 UTSW 15 34959036 missense probably benign 0.05
R7862:Stk3 UTSW 15 35115586 missense possibly damaging 0.90
R8354:Stk3 UTSW 15 34876724 missense probably damaging 1.00
R8454:Stk3 UTSW 15 34876724 missense probably damaging 1.00
R8996:Stk3 UTSW 15 34945062 missense possibly damaging 0.51
R9366:Stk3 UTSW 15 35072488 missense probably damaging 1.00
R9777:Stk3 UTSW 15 35114645 missense probably damaging 1.00
X0021:Stk3 UTSW 15 35072555 missense probably damaging 1.00
X0060:Stk3 UTSW 15 35114533 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGGGCAGAAGTGTCTTCTCTC -3'
(R):5'- TGAACTCTAGCTACAAACAGCG -3'

Sequencing Primer
(F):5'- GCAGAAGTGTCTTCTCTCAACCTC -3'
(R):5'- GCGCAATCTAAGTACAAGTTTACTCG -3'
Posted On 2022-01-20