Incidental Mutation 'R9160:Fer1l6'
ID 695659
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Name fer-1-like 6 (C. elegans)
Synonyms EG631797
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock # R9160 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 58510048-58665092 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 58643866 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1601 (E1601K)
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
AlphaFold E0CZ42
Predicted Effect possibly damaging
Transcript: ENSMUST00000161028
AA Change: E1601K

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: E1601K

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 G A 16: 20,560,496 R704H possibly damaging Het
Akap13 T C 7: 75,735,778 F533L possibly damaging Het
Ank3 G A 10: 70,002,474 V1771I unknown Het
Aspm T C 1: 139,490,124 L2911S probably damaging Het
Atp2b4 T C 1: 133,732,405 I380V probably benign Het
C2cd3 T A 7: 100,426,029 L739I Het
Cacng6 T C 7: 3,434,890 S245P probably benign Het
Chd5 A G 4: 152,385,459 S1830G probably damaging Het
Col20a1 T C 2: 180,999,745 M660T probably benign Het
Dnajc6 G A 4: 101,613,061 probably benign Het
Dock7 A G 4: 98,969,725 S1451P unknown Het
Ehd4 A G 2: 120,136,959 V118A probably damaging Het
Espl1 A G 15: 102,298,518 D139G probably damaging Het
Fermt3 A T 19: 7,014,417 L142Q probably damaging Het
Gfral A T 9: 76,197,090 N213K possibly damaging Het
Gria4 A G 9: 4,424,412 F818L probably damaging Het
H2-Eb1 A T 17: 34,309,857 R121* probably null Het
Hoxd9 A G 2: 74,699,417 D339G unknown Het
Hpn G T 7: 31,108,977 P78T probably benign Het
Inpp4b T A 8: 81,884,153 V175E possibly damaging Het
Itpr2 A G 6: 146,374,601 L736P probably damaging Het
Klhl6 G T 16: 19,957,022 P262Q probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mc5r A T 18: 68,339,134 Y188F probably damaging Het
Mob1b T C 5: 88,756,158 S218P probably benign Het
Mrgprb2 T C 7: 48,552,234 I248V possibly damaging Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Olfr1018 T A 2: 85,822,974 M1K probably null Het
Olfr1052 A T 2: 86,297,986 T57S probably benign Het
Olfr1394 G T 11: 49,160,434 W140L probably damaging Het
Olfr389 A T 11: 73,777,055 S91T probably benign Het
Pcdhga8 T A 18: 37,727,412 I507N probably damaging Het
Pkd1l2 T C 8: 117,040,669 D1294G possibly damaging Het
Psg28 A G 7: 18,430,715 L24P probably damaging Het
Ptk2 A T 15: 73,216,084 D868E probably benign Het
Ptpn6 G C 6: 124,728,172 R264G possibly damaging Het
Rnf10 T A 5: 115,260,190 M95L probably benign Het
Rnf40 C T 7: 127,591,821 T326I probably damaging Het
Rp1 G T 1: 4,346,497 T1464K probably benign Het
Satb1 T C 17: 51,740,025 E723G probably benign Het
Scgb3a2 T A 18: 43,767,380 probably benign Het
Sidt2 A G 9: 45,946,982 probably null Het
Sorcs1 A T 19: 50,225,220 C690S probably damaging Het
Spag16 T A 1: 69,923,714 M340K probably benign Het
Stk3 A G 15: 35,099,465 V107A probably damaging Het
Tlr1 T A 5: 64,926,310 H308L probably benign Het
Tmx2 A G 2: 84,673,563 F162S probably damaging Het
Vmn2r57 C T 7: 41,426,735 S451N possibly damaging Het
Zbtb49 T A 5: 38,205,902 I446F probably damaging Het
Zdhhc17 A T 10: 110,947,328 I493N probably damaging Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58662787 missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58558402 missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58637914 splice site probably null
R0304:Fer1l6 UTSW 15 58590562 missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58548338 missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58638094 critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58558408 splice site probably null
R0602:Fer1l6 UTSW 15 58577945 missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58662935 splice site probably null
R0669:Fer1l6 UTSW 15 58553724 splice site probably null
R0854:Fer1l6 UTSW 15 58559188 missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58564075 missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58602311 splice site probably benign
R1483:Fer1l6 UTSW 15 58637970 missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58641879 missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58647081 missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58557869 missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58625231 missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58602311 splice site probably benign
R2041:Fer1l6 UTSW 15 58558306 missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58627534 missense probably benign
R2145:Fer1l6 UTSW 15 58627534 missense probably benign
R2981:Fer1l6 UTSW 15 58564077 missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58559238 missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58647149 missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58627522 missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58626280 critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58640226 missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58553705 missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58640211 missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58577949 missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58618902 missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58638020 missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58600311 critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58571401 missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58643920 missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58640154 missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58550277 missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58581903 nonsense probably null
R5561:Fer1l6 UTSW 15 58660825 missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58558326 missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58622482 missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58571389 missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58590550 nonsense probably null
R5823:Fer1l6 UTSW 15 58590503 nonsense probably null
R5892:Fer1l6 UTSW 15 58564068 missense probably benign
R6006:Fer1l6 UTSW 15 58647044 missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58559206 missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58637957 missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58560639 missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58625177 nonsense probably null
R6237:Fer1l6 UTSW 15 58638006 missense probably damaging 1.00
R6271:Fer1l6 UTSW 15 58641918 missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58559232 nonsense probably null
R6784:Fer1l6 UTSW 15 58571426 missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58594878 missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58629378 missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58564050 missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58575297 missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58590535 missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58627597 missense probably benign
R7463:Fer1l6 UTSW 15 58573601 nonsense probably null
R7464:Fer1l6 UTSW 15 58573247 splice site probably null
R7469:Fer1l6 UTSW 15 58590570 splice site probably null
R7483:Fer1l6 UTSW 15 58641945 missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58600432 missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58638026 missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58560482 missense probably benign 0.00
R7580:Fer1l6 UTSW 15 58558396 missense probably benign 0.41
R7599:Fer1l6 UTSW 15 58627589 missense probably benign
R7607:Fer1l6 UTSW 15 58662732 nonsense probably null
R7677:Fer1l6 UTSW 15 58602290 missense probably benign 0.00
R8202:Fer1l6 UTSW 15 58630637 missense probably damaging 1.00
R8261:Fer1l6 UTSW 15 58560496 missense possibly damaging 0.84
R8847:Fer1l6 UTSW 15 58542163 missense possibly damaging 0.72
R9022:Fer1l6 UTSW 15 58583480 missense probably damaging 0.99
R9030:Fer1l6 UTSW 15 58630745 missense probably damaging 1.00
R9180:Fer1l6 UTSW 15 58622381 missense probably benign 0.19
R9289:Fer1l6 UTSW 15 58618917 missense probably damaging 1.00
R9559:Fer1l6 UTSW 15 58557910 missense possibly damaging 0.88
R9562:Fer1l6 UTSW 15 58618521 missense possibly damaging 0.70
R9682:Fer1l6 UTSW 15 58550264 missense probably benign 0.03
R9775:Fer1l6 UTSW 15 58625249 missense probably benign
X0021:Fer1l6 UTSW 15 58569202 nonsense probably null
X0027:Fer1l6 UTSW 15 58629340 missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58618574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGAAGGAGGAGCTACTCTG -3'
(R):5'- TTCCTTCCGTGGACTGTGAG -3'

Sequencing Primer
(F):5'- AGGAGCTACTCTGACCGACTC -3'
(R):5'- ACTGTGAGTGGTGGCTTCC -3'
Posted On 2022-01-20