Incidental Mutation 'R9160:Ptk2'
ID 695660
Institutional Source Beutler Lab
Gene Symbol Ptk2
Ensembl Gene ENSMUSG00000022607
Gene Name PTK2 protein tyrosine kinase 2
Synonyms FRNK, FAK, Fadk
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9160 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 73205102-73423280 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 73216084 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 868 (D868E)
Ref Sequence ENSEMBL: ENSMUSP00000105663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110036] [ENSMUST00000226988]
AlphaFold P34152
Predicted Effect probably benign
Transcript: ENSMUST00000110036
AA Change: D868E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000105663
Gene: ENSMUSG00000022607
AA Change: D868E

DomainStartEndE-ValueType
B41 31 258 1.49e-39 SMART
Blast:B41 288 333 1e-19 BLAST
TyrKc 422 676 1.11e-130 SMART
low complexity region 686 698 N/A INTRINSIC
low complexity region 712 726 N/A INTRINSIC
low complexity region 863 883 N/A INTRINSIC
Pfam:Focal_AT 914 1046 5e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226988
AA Change: D868E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is found concentrated in the focal adhesions that form between cells growing in the presence of extracellular matrix constituents. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Activation of this gene may be an important early step in cell growth and intracellular signal transduction pathways triggered in response to certain neural peptides or to cell interactions with the extracellular matrix. Several transcript variants encoding different isoforms have been found for this gene, but the full-length natures of only four of them have been determined. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele die before or during organogenesis with growth retardation, abnormal embryonic and extra embryonic tissue development, and abnormal vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 G A 16: 20,560,496 R704H possibly damaging Het
Akap13 T C 7: 75,735,778 F533L possibly damaging Het
Ank3 G A 10: 70,002,474 V1771I unknown Het
Aspm T C 1: 139,490,124 L2911S probably damaging Het
Atp2b4 T C 1: 133,732,405 I380V probably benign Het
C2cd3 T A 7: 100,426,029 L739I Het
Cacng6 T C 7: 3,434,890 S245P probably benign Het
Chd5 A G 4: 152,385,459 S1830G probably damaging Het
Col20a1 T C 2: 180,999,745 M660T probably benign Het
Dnajc6 G A 4: 101,613,061 probably benign Het
Dock7 A G 4: 98,969,725 S1451P unknown Het
Ehd4 A G 2: 120,136,959 V118A probably damaging Het
Espl1 A G 15: 102,298,518 D139G probably damaging Het
Fer1l6 G A 15: 58,643,866 E1601K possibly damaging Het
Fermt3 A T 19: 7,014,417 L142Q probably damaging Het
Gfral A T 9: 76,197,090 N213K possibly damaging Het
Gria4 A G 9: 4,424,412 F818L probably damaging Het
H2-Eb1 A T 17: 34,309,857 R121* probably null Het
Hoxd9 A G 2: 74,699,417 D339G unknown Het
Hpn G T 7: 31,108,977 P78T probably benign Het
Inpp4b T A 8: 81,884,153 V175E possibly damaging Het
Itpr2 A G 6: 146,374,601 L736P probably damaging Het
Klhl6 G T 16: 19,957,022 P262Q probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mc5r A T 18: 68,339,134 Y188F probably damaging Het
Mob1b T C 5: 88,756,158 S218P probably benign Het
Mrgprb2 T C 7: 48,552,234 I248V possibly damaging Het
Muc5ac T C 7: 141,809,792 I2280T unknown Het
Olfr1018 T A 2: 85,822,974 M1K probably null Het
Olfr1052 A T 2: 86,297,986 T57S probably benign Het
Olfr1394 G T 11: 49,160,434 W140L probably damaging Het
Olfr389 A T 11: 73,777,055 S91T probably benign Het
Pcdhga8 T A 18: 37,727,412 I507N probably damaging Het
Pkd1l2 T C 8: 117,040,669 D1294G possibly damaging Het
Psg28 A G 7: 18,430,715 L24P probably damaging Het
Ptpn6 G C 6: 124,728,172 R264G possibly damaging Het
Rnf10 T A 5: 115,260,190 M95L probably benign Het
Rnf40 C T 7: 127,591,821 T326I probably damaging Het
Rp1 G T 1: 4,346,497 T1464K probably benign Het
Satb1 T C 17: 51,740,025 E723G probably benign Het
Scgb3a2 T A 18: 43,767,380 probably benign Het
Sidt2 A G 9: 45,946,982 probably null Het
Sorcs1 A T 19: 50,225,220 C690S probably damaging Het
Spag16 T A 1: 69,923,714 M340K probably benign Het
Stk3 A G 15: 35,099,465 V107A probably damaging Het
Tlr1 T A 5: 64,926,310 H308L probably benign Het
Tmx2 A G 2: 84,673,563 F162S probably damaging Het
Vmn2r57 C T 7: 41,426,735 S451N possibly damaging Het
Zbtb49 T A 5: 38,205,902 I446F probably damaging Het
Zdhhc17 A T 10: 110,947,328 I493N probably damaging Het
Other mutations in Ptk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Ptk2 APN 15 73262547 missense probably damaging 1.00
IGL00913:Ptk2 APN 15 73295389 splice site probably benign
IGL01605:Ptk2 APN 15 73264339 splice site probably benign
IGL01631:Ptk2 APN 15 73216371 missense probably damaging 1.00
IGL01952:Ptk2 APN 15 73229931 missense probably damaging 0.99
IGL01957:Ptk2 APN 15 73242473 missense probably benign 0.05
IGL02441:Ptk2 APN 15 73320826 missense probably benign 0.16
IGL02471:Ptk2 APN 15 73298187 missense probably benign 0.41
IGL02621:Ptk2 APN 15 73206145 missense probably damaging 0.99
IGL03198:Ptk2 APN 15 73236216 missense probably damaging 1.00
Shooter UTSW 15 73304444 missense possibly damaging 0.83
R0239:Ptk2 UTSW 15 73343283 splice site probably null
R0239:Ptk2 UTSW 15 73343283 splice site probably null
R1254:Ptk2 UTSW 15 73229970 missense probably benign 0.01
R1291:Ptk2 UTSW 15 73210756 missense probably damaging 1.00
R1307:Ptk2 UTSW 15 73292046 missense probably benign 0.01
R1608:Ptk2 UTSW 15 73262575 missense probably damaging 0.98
R1690:Ptk2 UTSW 15 73262610 missense probably damaging 1.00
R1724:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1725:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1740:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1741:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1840:Ptk2 UTSW 15 73210884 missense probably damaging 1.00
R1956:Ptk2 UTSW 15 73215983 missense possibly damaging 0.49
R2022:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R2092:Ptk2 UTSW 15 73236191 nonsense probably null
R2114:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R2115:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R2336:Ptk2 UTSW 15 73266116 missense probably damaging 1.00
R2571:Ptk2 UTSW 15 73231919 missense probably damaging 1.00
R4232:Ptk2 UTSW 15 73309849 missense possibly damaging 0.61
R4245:Ptk2 UTSW 15 73231976 missense probably benign 0.00
R4594:Ptk2 UTSW 15 73206196 missense probably damaging 1.00
R4688:Ptk2 UTSW 15 73206225 missense probably damaging 1.00
R4834:Ptk2 UTSW 15 73216096 splice site probably null
R4847:Ptk2 UTSW 15 73231956 missense probably benign
R5558:Ptk2 UTSW 15 73304445 missense probably damaging 0.97
R5682:Ptk2 UTSW 15 73262564 nonsense probably null
R5858:Ptk2 UTSW 15 73321095 missense probably benign 0.12
R5951:Ptk2 UTSW 15 73303833 missense possibly damaging 0.88
R6014:Ptk2 UTSW 15 73304444 missense possibly damaging 0.83
R6027:Ptk2 UTSW 15 73229913 missense probably damaging 1.00
R6082:Ptk2 UTSW 15 73276865 missense probably damaging 1.00
R7025:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7031:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7032:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7077:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7078:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7079:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7090:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7091:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7092:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7136:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7137:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7798:Ptk2 UTSW 15 73295375 missense probably damaging 1.00
R8057:Ptk2 UTSW 15 73298199 frame shift probably null
R8235:Ptk2 UTSW 15 73343291 missense probably benign 0.00
R9106:Ptk2 UTSW 15 73259608 missense possibly damaging 0.95
R9301:Ptk2 UTSW 15 73274497 missense probably damaging 1.00
R9448:Ptk2 UTSW 15 73343192 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CCCACAGTCTTGTTGTCAGC -3'
(R):5'- AGGTTTCCTCTGCACTCAGTG -3'

Sequencing Primer
(F):5'- TGTTGTCAGCATCTCTAACCACAAC -3'
(R):5'- GCACTCAGTGTGGTGTTCACC -3'
Posted On 2022-01-20