Mutagenetix > Incidental Mutation

Incidental Mutation 'R9160:Mc5r'

695668

Institutional Source

Beutler Lab

Gene Symbol

Mc5r

Ensembl Gene

ENSMUSG00000007480

Gene Name

melanocortin 5 receptor

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.118) question?

Stock #

R9160 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

68337603-68339711 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 68339134 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 188 (Y188F)

Ref Sequence

ENSEMBL: ENSMUSP00000130497 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172148]

AlphaFold

P41149

Predicted Effect

probably damaging
Transcript: ENSMUST00000172148
AA Change: Y188F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130497
Gene: ENSMUSG00000007480
AA Change: Y188F

Domain	Start	End	E-Value	Type
low complexity region	49	62	N/A	INTRINSIC
Pfam:7tm_4	90	314	1.6e-10	PFAM
Pfam:7TM_GPCR_Srsx	94	357	9.8e-10	PFAM
Pfam:7tm_1	100	342	6.2e-33	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the seven-pass transmembrane G protein-coupled melanocortin receptor protein family that stimulate cAMP signal transduction. The encoded protein is a receptor for melanocyte-stimulating hormone and adrenocorticotropic hormone and is suggested to play a role in sebum generation. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous mutation of this gene results in a severe defect in water repulsion and thermoregulation due to decreased production of sebaceous lipids. Males exhibit less aggressive and more defensive behavior when placed with wildtype males. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcf3	G	A	16: 20,560,496	R704H	possibly damaging	Het
Akap13	T	C	7: 75,735,778	F533L	possibly damaging	Het
Ank3	G	A	10: 70,002,474	V1771I	unknown	Het
Aspm	T	C	1: 139,490,124	L2911S	probably damaging	Het
Atp2b4	T	C	1: 133,732,405	I380V	probably benign	Het
C2cd3	T	A	7: 100,426,029	L739I		Het
Cacng6	T	C	7: 3,434,890	S245P	probably benign	Het
Chd5	A	G	4: 152,385,459	S1830G	probably damaging	Het
Col20a1	T	C	2: 180,999,745	M660T	probably benign	Het
Dnajc6	G	A	4: 101,613,061		probably benign	Het
Dock7	A	G	4: 98,969,725	S1451P	unknown	Het
Ehd4	A	G	2: 120,136,959	V118A	probably damaging	Het
Espl1	A	G	15: 102,298,518	D139G	probably damaging	Het
Fer1l6	G	A	15: 58,643,866	E1601K	possibly damaging	Het
Fermt3	A	T	19: 7,014,417	L142Q	probably damaging	Het
Gfral	A	T	9: 76,197,090	N213K	possibly damaging	Het
Gria4	A	G	9: 4,424,412	F818L	probably damaging	Het
H2-Eb1	A	T	17: 34,309,857	R121*	probably null	Het
Hoxd9	A	G	2: 74,699,417	D339G	unknown	Het
Hpn	G	T	7: 31,108,977	P78T	probably benign	Het
Inpp4b	T	A	8: 81,884,153	V175E	possibly damaging	Het
Itpr2	A	G	6: 146,374,601	L736P	probably damaging	Het
Klhl6	G	T	16: 19,957,022	P262Q	probably damaging	Het
Ltbp2	G	A	12: 84,791,090	P1192L	probably benign	Het
Mob1b	T	C	5: 88,756,158	S218P	probably benign	Het
Mrgprb2	T	C	7: 48,552,234	I248V	possibly damaging	Het
Muc5ac	T	C	7: 141,809,792	I2280T	unknown	Het
Olfr1018	T	A	2: 85,822,974	M1K	probably null	Het
Olfr1052	A	T	2: 86,297,986	T57S	probably benign	Het
Olfr1394	G	T	11: 49,160,434	W140L	probably damaging	Het
Olfr389	A	T	11: 73,777,055	S91T	probably benign	Het
Pcdhga8	T	A	18: 37,727,412	I507N	probably damaging	Het
Pkd1l2	T	C	8: 117,040,669	D1294G	possibly damaging	Het
Psg28	A	G	7: 18,430,715	L24P	probably damaging	Het
Ptk2	A	T	15: 73,216,084	D868E	probably benign	Het
Ptpn6	G	C	6: 124,728,172	R264G	possibly damaging	Het
Rnf10	T	A	5: 115,260,190	M95L	probably benign	Het
Rnf40	C	T	7: 127,591,821	T326I	probably damaging	Het
Rp1	G	T	1: 4,346,497	T1464K	probably benign	Het
Satb1	T	C	17: 51,740,025	E723G	probably benign	Het
Scgb3a2	T	A	18: 43,767,380		probably benign	Het
Sidt2	A	G	9: 45,946,982		probably null	Het
Sorcs1	A	T	19: 50,225,220	C690S	probably damaging	Het
Spag16	T	A	1: 69,923,714	M340K	probably benign	Het
Stk3	A	G	15: 35,099,465	V107A	probably damaging	Het
Tlr1	T	A	5: 64,926,310	H308L	probably benign	Het
Tmx2	A	G	2: 84,673,563	F162S	probably damaging	Het
Vmn2r57	C	T	7: 41,426,735	S451N	possibly damaging	Het
Zbtb49	T	A	5: 38,205,902	I446F	probably damaging	Het
Zdhhc17	A	T	10: 110,947,328	I493N	probably damaging	Het

Other mutations in Mc5r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01483:Mc5r	APN	18	68339244	missense	probably damaging	1.00
IGL02396:Mc5r	APN	18	68339466	missense	possibly damaging	0.88
IGL02474:Mc5r	APN	18	68338839	missense	probably damaging	1.00
IGL02489:Mc5r	APN	18	68339526	missense	probably damaging	0.99
IGL03323:Mc5r	APN	18	68339215	missense	probably benign	0.00
R0022:Mc5r	UTSW	18	68338782	missense	probably benign
R0022:Mc5r	UTSW	18	68338782	missense	probably benign
R0067:Mc5r	UTSW	18	68339566	missense	probably damaging	1.00
R0067:Mc5r	UTSW	18	68339566	missense	probably damaging	1.00
R0883:Mc5r	UTSW	18	68339092	missense	probably damaging	1.00
R1179:Mc5r	UTSW	18	68338670	splice site	probably null
R1789:Mc5r	UTSW	18	68338670	splice site	probably null
R1866:Mc5r	UTSW	18	68338670	splice site	probably null
R2291:Mc5r	UTSW	18	68339364	missense	probably damaging	1.00
R4297:Mc5r	UTSW	18	68339307	missense	probably benign	0.00
R4960:Mc5r	UTSW	18	68338819	missense	possibly damaging	0.50
R5062:Mc5r	UTSW	18	68339281	missense	probably damaging	1.00
R5521:Mc5r	UTSW	18	68339677	missense	possibly damaging	0.73
R5853:Mc5r	UTSW	18	68339493	missense	probably benign	0.25
R6007:Mc5r	UTSW	18	68339247	missense	possibly damaging	0.93
R7326:Mc5r	UTSW	18	68339668	missense	probably damaging	1.00
R9287:Mc5r	UTSW	18	68339129	missense	probably damaging	1.00
R9471:Mc5r	UTSW	18	68339056	missense	probably damaging	1.00
R9511:Mc5r	UTSW	18	68339494	missense	possibly damaging	0.65

Predicted Primers

PCR Primer
(F):5'- GCTGGTGAGCATGTCCAATG -3'
(R):5'- CTATCCGCTTGACATGGTTCCG -3'

Sequencing Primer
(F):5'- GCCTGGGAGACTGTCACCATATAC -3'
(R):5'- TTGACATGGTTCCGGGCCAG -3'

Posted On

2022-01-20