Incidental Mutation 'R9161:Atrn'
ID 695681
Institutional Source Beutler Lab
Gene Symbol Atrn
Ensembl Gene ENSMUSG00000027312
Gene Name attractin
Synonyms Mgca
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9161 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 130748415-130872253 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 130777470 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 173 (F173S)
Ref Sequence ENSEMBL: ENSMUSP00000028781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028781]
AlphaFold Q9WU60
Predicted Effect probably damaging
Transcript: ENSMUST00000028781
AA Change: F173S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: F173S

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
EGF 99 129 9.85e-5 SMART
CUB 131 247 7.85e-18 SMART
EGF 248 282 1.47e1 SMART
Pfam:Kelch_1 339 382 1.1e-7 PFAM
Pfam:Kelch_5 389 434 2.5e-7 PFAM
Pfam:Kelch_6 390 439 3.3e-8 PFAM
Pfam:Kelch_1 553 606 8.4e-8 PFAM
PSI 646 693 7.41e-7 SMART
PSI 702 747 8.64e-8 SMART
PSI 754 799 2.11e-2 SMART
CLECT 787 918 6.14e-20 SMART
PSI 931 982 1.11e-5 SMART
PSI 985 1060 1.2e-6 SMART
EGF_Lam 1062 1105 1.97e-4 SMART
EGF_like 1108 1154 3.9e0 SMART
transmembrane domain 1278 1300 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 T A 8: 13,272,270 (GRCm39) N1496I probably damaging Het
Arglu1 T C 8: 8,733,941 (GRCm39) E125G possibly damaging Het
Atad2 A T 15: 57,989,185 (GRCm39) I225N possibly damaging Het
BC024063 T A 10: 81,945,044 (GRCm39) H221Q probably benign Het
Bnip5 T A 17: 29,128,387 (GRCm39) K175N probably damaging Het
Btbd16 C T 7: 130,417,516 (GRCm39) R344C probably damaging Het
Cdh24 A T 14: 54,876,097 (GRCm39) Y182N probably damaging Het
Cdkl4 A G 17: 80,851,120 (GRCm39) L194P probably damaging Het
Cep152 T A 2: 125,408,574 (GRCm39) R1327* probably null Het
Ckap5 A T 2: 91,445,653 (GRCm39) M1797L probably benign Het
Clasp1 A T 1: 118,474,651 (GRCm39) N895I probably damaging Het
Col15a1 G C 4: 47,288,200 (GRCm39) probably benign Het
Cotl1 G T 8: 120,549,456 (GRCm39) D85E probably benign Het
Cryba4 A C 5: 112,396,039 (GRCm39) probably null Het
Dync1h1 A G 12: 110,625,023 (GRCm39) K3817E probably benign Het
Ehd3 A T 17: 74,134,480 (GRCm39) R280* probably null Het
Erp29 T C 5: 121,583,146 (GRCm39) E260G possibly damaging Het
Fam135b T A 15: 71,334,417 (GRCm39) R926W possibly damaging Het
Fbn1 T C 2: 125,192,270 (GRCm39) N1413S probably damaging Het
Fbxw8 A G 5: 118,251,727 (GRCm39) V262A probably damaging Het
Gabrb1 A G 5: 72,187,199 (GRCm39) D164G probably damaging Het
Galnt15 T A 14: 31,780,116 (GRCm39) I471N probably damaging Het
Get1 A T 16: 95,953,139 (GRCm39) R77W probably damaging Het
Gon4l A G 3: 88,808,955 (GRCm39) N1733S probably damaging Het
Hmcn2 A G 2: 31,242,758 (GRCm39) T562A probably benign Het
Inha A G 1: 75,484,144 (GRCm39) I85V probably damaging Het
Kif28 A C 1: 179,526,244 (GRCm39) V897G probably benign Het
Map1s G A 8: 71,366,250 (GRCm39) R385H probably damaging Het
Map2 T C 1: 66,477,503 (GRCm39) V1750A possibly damaging Het
Mbd1 C T 18: 74,407,792 (GRCm39) P273L probably benign Het
Megf6 A G 4: 154,352,172 (GRCm39) T1226A probably benign Het
Muc5ac T A 7: 141,353,026 (GRCm39) C791S possibly damaging Het
Nlrc5 A C 8: 95,213,274 (GRCm39) H883P probably damaging Het
Nrip3 C T 7: 109,365,777 (GRCm39) R91H probably damaging Het
Or10w1 G A 19: 13,632,038 (GRCm39) V82M probably damaging Het
Or12j3 C T 7: 139,952,989 (GRCm39) C178Y probably damaging Het
Or51a10 C A 7: 103,699,725 (GRCm39) probably benign Het
Or8g21 A T 9: 38,905,816 (GRCm39) I305K possibly damaging Het
Or8k16 A G 2: 85,520,231 (GRCm39) T153A probably benign Het
Pdgfrb T G 18: 61,197,053 (GRCm39) L163R probably damaging Het
Pik3ip1 G T 11: 3,281,945 (GRCm39) R34L possibly damaging Het
Pip4k2b A G 11: 97,615,245 (GRCm39) F205S possibly damaging Het
Pttg1ip A C 10: 77,425,487 (GRCm39) N60T probably benign Het
Rab3ip C T 10: 116,750,066 (GRCm39) E356K probably damaging Het
Rai1 A G 11: 60,076,682 (GRCm39) N249D probably benign Het
Rd3l T C 12: 111,946,753 (GRCm39) K8E probably damaging Het
Rnf32 A G 5: 29,408,058 (GRCm39) K96E probably damaging Het
Rsf1 GGCG GGCGACCGCCGCG 7: 97,229,113 (GRCm39) probably benign Het
Slc4a1ap A G 5: 31,685,474 (GRCm39) K251E Het
Spink5 T A 18: 44,147,986 (GRCm39) N875K probably damaging Het
Taf6 G T 5: 138,178,160 (GRCm39) A447D probably benign Het
Tbxas1 A T 6: 38,999,989 (GRCm39) I259F probably damaging Het
Tcap G T 11: 98,275,256 (GRCm39) R130L probably damaging Het
Tyms T C 5: 30,266,040 (GRCm39) E293G Het
Vmn1r20 C A 6: 57,408,759 (GRCm39) F28L probably benign Het
Vmn2r120 A T 17: 57,831,864 (GRCm39) D308E Het
Vmn2r69 T A 7: 85,056,177 (GRCm39) I654F possibly damaging Het
Zfp990 G T 4: 145,261,509 (GRCm39) V52L possibly damaging Het
Other mutations in Atrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Atrn APN 2 130,799,999 (GRCm39) missense probably damaging 1.00
IGL00571:Atrn APN 2 130,836,968 (GRCm39) missense probably damaging 1.00
IGL01092:Atrn APN 2 130,789,556 (GRCm39) nonsense probably null
IGL01572:Atrn APN 2 130,844,715 (GRCm39) missense probably damaging 1.00
IGL01924:Atrn APN 2 130,777,485 (GRCm39) missense probably damaging 1.00
IGL02116:Atrn APN 2 130,800,009 (GRCm39) missense probably damaging 1.00
IGL02372:Atrn APN 2 130,844,674 (GRCm39) splice site probably benign
IGL02390:Atrn APN 2 130,862,897 (GRCm39) missense possibly damaging 0.82
IGL02548:Atrn APN 2 130,814,202 (GRCm39) missense probably damaging 1.00
IGL02749:Atrn APN 2 130,789,654 (GRCm39) splice site probably benign
IGL02749:Atrn APN 2 130,812,064 (GRCm39) nonsense probably null
BB010:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
BB020:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
R0026:Atrn UTSW 2 130,799,840 (GRCm39) missense probably damaging 1.00
R0403:Atrn UTSW 2 130,748,779 (GRCm39) missense probably damaging 1.00
R0479:Atrn UTSW 2 130,841,085 (GRCm39) nonsense probably null
R0544:Atrn UTSW 2 130,828,746 (GRCm39) missense probably damaging 1.00
R0570:Atrn UTSW 2 130,822,054 (GRCm39) missense probably benign 0.01
R0606:Atrn UTSW 2 130,748,776 (GRCm39) missense possibly damaging 0.90
R0617:Atrn UTSW 2 130,837,005 (GRCm39) critical splice donor site probably null
R0658:Atrn UTSW 2 130,812,147 (GRCm39) critical splice donor site probably null
R1108:Atrn UTSW 2 130,799,834 (GRCm39) missense probably damaging 1.00
R1112:Atrn UTSW 2 130,841,081 (GRCm39) missense probably benign 0.04
R1219:Atrn UTSW 2 130,862,927 (GRCm39) missense possibly damaging 0.90
R1422:Atrn UTSW 2 130,799,834 (GRCm39) missense probably damaging 1.00
R1524:Atrn UTSW 2 130,799,000 (GRCm39) missense probably benign 0.15
R1653:Atrn UTSW 2 130,777,544 (GRCm39) missense probably benign
R1795:Atrn UTSW 2 130,814,208 (GRCm39) missense probably benign
R1807:Atrn UTSW 2 130,824,692 (GRCm39) missense possibly damaging 0.94
R1920:Atrn UTSW 2 130,836,971 (GRCm39) missense probably damaging 1.00
R1921:Atrn UTSW 2 130,836,971 (GRCm39) missense probably damaging 1.00
R1935:Atrn UTSW 2 130,799,955 (GRCm39) missense probably damaging 1.00
R1982:Atrn UTSW 2 130,812,142 (GRCm39) missense probably benign
R2000:Atrn UTSW 2 130,777,508 (GRCm39) missense probably damaging 1.00
R2143:Atrn UTSW 2 130,799,916 (GRCm39) missense probably benign 0.03
R2336:Atrn UTSW 2 130,799,874 (GRCm39) missense probably damaging 1.00
R2679:Atrn UTSW 2 130,803,595 (GRCm39) critical splice donor site probably null
R3426:Atrn UTSW 2 130,862,876 (GRCm39) missense probably benign 0.06
R3909:Atrn UTSW 2 130,836,127 (GRCm39) missense probably damaging 1.00
R4077:Atrn UTSW 2 130,806,850 (GRCm39) critical splice donor site probably null
R4162:Atrn UTSW 2 130,836,148 (GRCm39) splice site probably benign
R4195:Atrn UTSW 2 130,775,332 (GRCm39) missense probably damaging 1.00
R4364:Atrn UTSW 2 130,812,128 (GRCm39) missense probably benign 0.39
R4465:Atrn UTSW 2 130,802,388 (GRCm39) missense probably benign 0.08
R4510:Atrn UTSW 2 130,777,497 (GRCm39) nonsense probably null
R4511:Atrn UTSW 2 130,777,497 (GRCm39) nonsense probably null
R4527:Atrn UTSW 2 130,815,424 (GRCm39) missense probably benign 0.10
R4586:Atrn UTSW 2 130,823,962 (GRCm39) missense probably damaging 1.00
R4592:Atrn UTSW 2 130,841,050 (GRCm39) intron probably benign
R4658:Atrn UTSW 2 130,775,349 (GRCm39) missense probably damaging 1.00
R4735:Atrn UTSW 2 130,862,910 (GRCm39) missense probably benign 0.06
R4960:Atrn UTSW 2 130,836,967 (GRCm39) nonsense probably null
R4999:Atrn UTSW 2 130,817,874 (GRCm39) missense probably damaging 1.00
R5066:Atrn UTSW 2 130,836,113 (GRCm39) missense possibly damaging 0.60
R5080:Atrn UTSW 2 130,812,044 (GRCm39) missense possibly damaging 0.95
R5141:Atrn UTSW 2 130,841,050 (GRCm39) intron probably benign
R5256:Atrn UTSW 2 130,787,939 (GRCm39) missense probably benign 0.39
R5494:Atrn UTSW 2 130,864,995 (GRCm39) missense probably damaging 1.00
R5678:Atrn UTSW 2 130,811,936 (GRCm39) missense probably damaging 0.96
R5752:Atrn UTSW 2 130,748,464 (GRCm39) unclassified probably benign
R5931:Atrn UTSW 2 130,775,356 (GRCm39) missense possibly damaging 0.56
R6023:Atrn UTSW 2 130,862,900 (GRCm39) missense probably benign 0.25
R6176:Atrn UTSW 2 130,788,011 (GRCm39) missense probably benign 0.31
R6377:Atrn UTSW 2 130,821,889 (GRCm39) missense probably damaging 1.00
R6433:Atrn UTSW 2 130,864,947 (GRCm39) missense probably damaging 1.00
R7226:Atrn UTSW 2 130,828,664 (GRCm39) missense probably damaging 0.99
R7402:Atrn UTSW 2 130,789,520 (GRCm39) missense probably damaging 1.00
R7541:Atrn UTSW 2 130,803,491 (GRCm39) missense possibly damaging 0.46
R7587:Atrn UTSW 2 130,822,034 (GRCm39) missense probably damaging 1.00
R7872:Atrn UTSW 2 130,812,147 (GRCm39) critical splice donor site probably null
R7910:Atrn UTSW 2 130,806,807 (GRCm39) missense probably benign 0.04
R7913:Atrn UTSW 2 130,812,131 (GRCm39) missense probably damaging 1.00
R7933:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
R8044:Atrn UTSW 2 130,777,449 (GRCm39) missense probably damaging 1.00
R8079:Atrn UTSW 2 130,855,561 (GRCm39) missense probably null 1.00
R8093:Atrn UTSW 2 130,817,908 (GRCm39) missense probably benign 0.00
R8203:Atrn UTSW 2 130,802,469 (GRCm39) missense probably benign 0.00
R8234:Atrn UTSW 2 130,864,920 (GRCm39) critical splice acceptor site probably null
R8462:Atrn UTSW 2 130,777,504 (GRCm39) missense probably damaging 1.00
R8816:Atrn UTSW 2 130,846,494 (GRCm39) missense probably damaging 1.00
R8816:Atrn UTSW 2 130,748,798 (GRCm39) missense probably damaging 1.00
R8831:Atrn UTSW 2 130,748,521 (GRCm39) missense probably benign 0.22
R8937:Atrn UTSW 2 130,841,157 (GRCm39) missense probably benign 0.00
R9722:Atrn UTSW 2 130,803,536 (GRCm39) missense probably damaging 1.00
R9786:Atrn UTSW 2 130,786,809 (GRCm39) missense probably damaging 1.00
RF009:Atrn UTSW 2 130,748,842 (GRCm39) missense probably benign 0.12
X0024:Atrn UTSW 2 130,800,059 (GRCm39) missense probably damaging 1.00
Z1088:Atrn UTSW 2 130,815,319 (GRCm39) missense probably benign
Z1176:Atrn UTSW 2 130,788,113 (GRCm39) missense probably benign 0.27
Z1177:Atrn UTSW 2 130,787,962 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGCCCGTGTCTCTTTTGG -3'
(R):5'- CCATGAGATGAGTGTGACTGC -3'

Sequencing Primer
(F):5'- GGTTCCCAGGACATTTTTGATATTC -3'
(R):5'- CTGCAGAATAAAGTAAATGCAGCAC -3'
Posted On 2022-01-20