Mutagenetix > Incidental Mutation

Incidental Mutation 'R9161:Atrn'

695681

Institutional Source

Beutler Lab

Gene Symbol

Atrn

Ensembl Gene

ENSMUSG00000027312

Gene Name

attractin

Synonyms

Mgca

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9161 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

130906495-131030333 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 130935550 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 173 (F173S)

Ref Sequence

ENSEMBL: ENSMUSP00000028781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028781]

AlphaFold

Q9WU60

Predicted Effect

probably damaging
Transcript: ENSMUST00000028781
AA Change: F173S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: F173S

Domain	Start	End	E-Value	Type
low complexity region	2	9	N/A	INTRINSIC
low complexity region	51	97	N/A	INTRINSIC
EGF	99	129	9.85e-5	SMART
CUB	131	247	7.85e-18	SMART
EGF	248	282	1.47e1	SMART
Pfam:Kelch_1	339	382	1.1e-7	PFAM
Pfam:Kelch_5	389	434	2.5e-7	PFAM
Pfam:Kelch_6	390	439	3.3e-8	PFAM
Pfam:Kelch_1	553	606	8.4e-8	PFAM
PSI	646	693	7.41e-7	SMART
PSI	702	747	8.64e-8	SMART
PSI	754	799	2.11e-2	SMART
CLECT	787	918	6.14e-20	SMART
PSI	931	982	1.11e-5	SMART
PSI	985	1060	1.2e-6	SMART
EGF_Lam	1062	1105	1.97e-4	SMART
EGF_like	1108	1154	3.9e0	SMART
transmembrane domain	1278	1300	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
low complexity region	1373	1385	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930539E08Rik	T	A	17: 28,909,413	K175N	probably damaging	Het
Adprhl1	T	A	8: 13,222,270	N1496I	probably damaging	Het
Arglu1	T	C	8: 8,683,941	E125G	possibly damaging	Het
Atad2	A	T	15: 58,125,789	I225N	possibly damaging	Het
BC024063	T	A	10: 82,109,210	H221Q	probably benign	Het
Btbd16	C	T	7: 130,815,786	R344C	probably damaging	Het
Cdh24	A	T	14: 54,638,640	Y182N	probably damaging	Het
Cdkl4	A	G	17: 80,543,691	L194P	probably damaging	Het
Cep152	T	A	2: 125,566,654	R1327*	probably null	Het
Ckap5	A	T	2: 91,615,308	M1797L	probably benign	Het
Clasp1	A	T	1: 118,546,921	N895I	probably damaging	Het
Col15a1	G	C	4: 47,288,200		probably benign	Het
Cotl1	G	T	8: 119,822,717	D85E	probably benign	Het
Cryba4	A	C	5: 112,248,173		probably null	Het
Dync1h1	A	G	12: 110,658,589	K3817E	probably benign	Het
Ehd3	A	T	17: 73,827,485	R280*	probably null	Het
Erp29	T	C	5: 121,445,083	E260G	possibly damaging	Het
Fam135b	T	A	15: 71,462,568	R926W	possibly damaging	Het
Fbn1	T	C	2: 125,350,350	N1413S	probably damaging	Het
Fbxw8	A	G	5: 118,113,662	V262A	probably damaging	Het
Gabrb1	A	G	5: 72,029,856	D164G	probably damaging	Het
Galnt15	T	A	14: 32,058,159	I471N	probably damaging	Het
Gon4l	A	G	3: 88,901,648	N1733S	probably damaging	Het
Hmcn2	A	G	2: 31,352,746	T562A	probably benign	Het
Inha	A	G	1: 75,507,500	I85V	probably damaging	Het
Kif28	A	C	1: 179,698,679	V897G	probably benign	Het
Map1s	G	A	8: 70,913,606	R385H	probably damaging	Het
Map2	T	C	1: 66,438,344	V1750A	possibly damaging	Het
Mbd1	C	T	18: 74,274,721	P273L	probably benign	Het
Megf6	A	G	4: 154,267,715	T1226A	probably benign	Het
Muc5ac	T	A	7: 141,799,289	C791S	possibly damaging	Het
Nlrc5	A	C	8: 94,486,646	H883P	probably damaging	Het
Nrip3	C	T	7: 109,766,570	R91H	probably damaging	Het
Olfr1008	A	G	2: 85,689,887	T153A	probably benign	Het
Olfr1490	G	A	19: 13,654,674	V82M	probably damaging	Het
Olfr530	C	T	7: 140,373,076	C178Y	probably damaging	Het
Olfr642	C	A	7: 104,050,518		probably benign	Het
Olfr935	A	T	9: 38,994,520	I305K	possibly damaging	Het
Pdgfrb	T	G	18: 61,063,981	L163R	probably damaging	Het
Pik3ip1	G	T	11: 3,331,945	R34L	possibly damaging	Het
Pip4k2b	A	G	11: 97,724,419	F205S	possibly damaging	Het
Pttg1ip	A	C	10: 77,589,653	N60T	probably benign	Het
Rab3ip	C	T	10: 116,914,161	E356K	probably damaging	Het
Rai1	A	G	11: 60,185,856	N249D	probably benign	Het
Rd3l	T	C	12: 111,980,319	K8E	probably damaging	Het
Rnf32	A	G	5: 29,203,060	K96E	probably damaging	Het
Rsf1	GGCG	GGCGACCGCCGCG	7: 97,579,906		probably benign	Het
Slc4a1ap	A	G	5: 31,528,130	K251E		Het
Spink5	T	A	18: 44,014,919	N875K	probably damaging	Het
Taf6	G	T	5: 138,179,898	A447D	probably benign	Het
Tbxas1	A	T	6: 39,023,055	I259F	probably damaging	Het
Tcap	G	T	11: 98,384,430	R130L	probably damaging	Het
Tyms	T	C	5: 30,061,042	E293G		Het
Vmn1r20	C	A	6: 57,431,774	F28L	probably benign	Het
Vmn2r120	A	T	17: 57,524,864	D308E		Het
Vmn2r69	T	A	7: 85,406,969	I654F	possibly damaging	Het
Wrb	A	T	16: 96,151,939	R77W	probably damaging	Het
Zfp990	G	T	4: 145,534,939	V52L	possibly damaging	Het

Other mutations in Atrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Atrn	APN	2	130958079	missense	probably damaging	1.00
IGL00571:Atrn	APN	2	130995048	missense	probably damaging	1.00
IGL01092:Atrn	APN	2	130947636	nonsense	probably null
IGL01572:Atrn	APN	2	131002795	missense	probably damaging	1.00
IGL01924:Atrn	APN	2	130935565	missense	probably damaging	1.00
IGL02116:Atrn	APN	2	130958089	missense	probably damaging	1.00
IGL02372:Atrn	APN	2	131002754	splice site	probably benign
IGL02390:Atrn	APN	2	131020977	missense	possibly damaging	0.82
IGL02548:Atrn	APN	2	130972282	missense	probably damaging	1.00
IGL02749:Atrn	APN	2	130970144	nonsense	probably null
IGL02749:Atrn	APN	2	130947734	splice site	probably benign
BB010:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
BB020:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R0026:Atrn	UTSW	2	130957920	missense	probably damaging	1.00
R0403:Atrn	UTSW	2	130906859	missense	probably damaging	1.00
R0479:Atrn	UTSW	2	130999165	nonsense	probably null
R0544:Atrn	UTSW	2	130986826	missense	probably damaging	1.00
R0570:Atrn	UTSW	2	130980134	missense	probably benign	0.01
R0606:Atrn	UTSW	2	130906856	missense	possibly damaging	0.90
R0617:Atrn	UTSW	2	130995085	critical splice donor site	probably null
R0658:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R1108:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1112:Atrn	UTSW	2	130999161	missense	probably benign	0.04
R1219:Atrn	UTSW	2	131021007	missense	possibly damaging	0.90
R1422:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1524:Atrn	UTSW	2	130957080	missense	probably benign	0.15
R1653:Atrn	UTSW	2	130935624	missense	probably benign
R1795:Atrn	UTSW	2	130972288	missense	probably benign
R1807:Atrn	UTSW	2	130982772	missense	possibly damaging	0.94
R1920:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1921:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1935:Atrn	UTSW	2	130958035	missense	probably damaging	1.00
R1982:Atrn	UTSW	2	130970222	missense	probably benign
R2000:Atrn	UTSW	2	130935588	missense	probably damaging	1.00
R2143:Atrn	UTSW	2	130957996	missense	probably benign	0.03
R2336:Atrn	UTSW	2	130957954	missense	probably damaging	1.00
R2679:Atrn	UTSW	2	130961675	critical splice donor site	probably null
R3426:Atrn	UTSW	2	131020956	missense	probably benign	0.06
R3909:Atrn	UTSW	2	130994207	missense	probably damaging	1.00
R4077:Atrn	UTSW	2	130964930	critical splice donor site	probably null
R4162:Atrn	UTSW	2	130994228	splice site	probably benign
R4195:Atrn	UTSW	2	130933412	missense	probably damaging	1.00
R4364:Atrn	UTSW	2	130970208	missense	probably benign	0.39
R4465:Atrn	UTSW	2	130960468	missense	probably benign	0.08
R4510:Atrn	UTSW	2	130935577	nonsense	probably null
R4511:Atrn	UTSW	2	130935577	nonsense	probably null
R4527:Atrn	UTSW	2	130973504	missense	probably benign	0.10
R4586:Atrn	UTSW	2	130982042	missense	probably damaging	1.00
R4592:Atrn	UTSW	2	130999130	intron	probably benign
R4658:Atrn	UTSW	2	130933429	missense	probably damaging	1.00
R4735:Atrn	UTSW	2	131020990	missense	probably benign	0.06
R4960:Atrn	UTSW	2	130995047	nonsense	probably null
R4999:Atrn	UTSW	2	130975954	missense	probably damaging	1.00
R5066:Atrn	UTSW	2	130994193	missense	possibly damaging	0.60
R5080:Atrn	UTSW	2	130970124	missense	possibly damaging	0.95
R5141:Atrn	UTSW	2	130999130	intron	probably benign
R5256:Atrn	UTSW	2	130946019	missense	probably benign	0.39
R5494:Atrn	UTSW	2	131023075	missense	probably damaging	1.00
R5678:Atrn	UTSW	2	130970016	missense	probably damaging	0.96
R5752:Atrn	UTSW	2	130906544	unclassified	probably benign
R5931:Atrn	UTSW	2	130933436	missense	possibly damaging	0.56
R6023:Atrn	UTSW	2	131020980	missense	probably benign	0.25
R6176:Atrn	UTSW	2	130946091	missense	probably benign	0.31
R6377:Atrn	UTSW	2	130979969	missense	probably damaging	1.00
R6433:Atrn	UTSW	2	131023027	missense	probably damaging	1.00
R7226:Atrn	UTSW	2	130986744	missense	probably damaging	0.99
R7402:Atrn	UTSW	2	130947600	missense	probably damaging	1.00
R7541:Atrn	UTSW	2	130961571	missense	possibly damaging	0.46
R7587:Atrn	UTSW	2	130980114	missense	probably damaging	1.00
R7872:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R7910:Atrn	UTSW	2	130964887	missense	probably benign	0.04
R7913:Atrn	UTSW	2	130970211	missense	probably damaging	1.00
R7933:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R8044:Atrn	UTSW	2	130935529	missense	probably damaging	1.00
R8079:Atrn	UTSW	2	131013641	missense	probably null	1.00
R8093:Atrn	UTSW	2	130975988	missense	probably benign	0.00
R8203:Atrn	UTSW	2	130960549	missense	probably benign	0.00
R8234:Atrn	UTSW	2	131023000	critical splice acceptor site	probably null
R8462:Atrn	UTSW	2	130935584	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	130906878	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	131004574	missense	probably damaging	1.00
R8831:Atrn	UTSW	2	130906601	missense	probably benign	0.22
R8937:Atrn	UTSW	2	130999237	missense	probably benign	0.00
R9722:Atrn	UTSW	2	130961616	missense	probably damaging	1.00
R9786:Atrn	UTSW	2	130944889	missense	probably damaging	1.00
RF009:Atrn	UTSW	2	130906922	missense	probably benign	0.12
X0024:Atrn	UTSW	2	130958139	missense	probably damaging	1.00
Z1088:Atrn	UTSW	2	130973399	missense	probably benign
Z1176:Atrn	UTSW	2	130946193	missense	probably benign	0.27
Z1177:Atrn	UTSW	2	130946042	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGAGCCCGTGTCTCTTTTGG -3'
(R):5'- CCATGAGATGAGTGTGACTGC -3'

Sequencing Primer
(F):5'- GGTTCCCAGGACATTTTTGATATTC -3'
(R):5'- CTGCAGAATAAAGTAAATGCAGCAC -3'

Posted On

2022-01-20