Incidental Mutation 'R9161:Atrn'
ID 695681
Institutional Source Beutler Lab
Gene Symbol Atrn
Ensembl Gene ENSMUSG00000027312
Gene Name attractin
Synonyms Mgca
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9161 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 130906495-131030333 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 130935550 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 173 (F173S)
Ref Sequence ENSEMBL: ENSMUSP00000028781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028781]
AlphaFold Q9WU60
Predicted Effect probably damaging
Transcript: ENSMUST00000028781
AA Change: F173S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: F173S

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
EGF 99 129 9.85e-5 SMART
CUB 131 247 7.85e-18 SMART
EGF 248 282 1.47e1 SMART
Pfam:Kelch_1 339 382 1.1e-7 PFAM
Pfam:Kelch_5 389 434 2.5e-7 PFAM
Pfam:Kelch_6 390 439 3.3e-8 PFAM
Pfam:Kelch_1 553 606 8.4e-8 PFAM
PSI 646 693 7.41e-7 SMART
PSI 702 747 8.64e-8 SMART
PSI 754 799 2.11e-2 SMART
CLECT 787 918 6.14e-20 SMART
PSI 931 982 1.11e-5 SMART
PSI 985 1060 1.2e-6 SMART
EGF_Lam 1062 1105 1.97e-4 SMART
EGF_like 1108 1154 3.9e0 SMART
transmembrane domain 1278 1300 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T A 17: 28,909,413 K175N probably damaging Het
Adprhl1 T A 8: 13,222,270 N1496I probably damaging Het
Arglu1 T C 8: 8,683,941 E125G possibly damaging Het
Atad2 A T 15: 58,125,789 I225N possibly damaging Het
BC024063 T A 10: 82,109,210 H221Q probably benign Het
Btbd16 C T 7: 130,815,786 R344C probably damaging Het
Cdh24 A T 14: 54,638,640 Y182N probably damaging Het
Cdkl4 A G 17: 80,543,691 L194P probably damaging Het
Cep152 T A 2: 125,566,654 R1327* probably null Het
Ckap5 A T 2: 91,615,308 M1797L probably benign Het
Clasp1 A T 1: 118,546,921 N895I probably damaging Het
Col15a1 G C 4: 47,288,200 probably benign Het
Cotl1 G T 8: 119,822,717 D85E probably benign Het
Cryba4 A C 5: 112,248,173 probably null Het
Dync1h1 A G 12: 110,658,589 K3817E probably benign Het
Ehd3 A T 17: 73,827,485 R280* probably null Het
Erp29 T C 5: 121,445,083 E260G possibly damaging Het
Fam135b T A 15: 71,462,568 R926W possibly damaging Het
Fbn1 T C 2: 125,350,350 N1413S probably damaging Het
Fbxw8 A G 5: 118,113,662 V262A probably damaging Het
Gabrb1 A G 5: 72,029,856 D164G probably damaging Het
Galnt15 T A 14: 32,058,159 I471N probably damaging Het
Gon4l A G 3: 88,901,648 N1733S probably damaging Het
Hmcn2 A G 2: 31,352,746 T562A probably benign Het
Inha A G 1: 75,507,500 I85V probably damaging Het
Kif28 A C 1: 179,698,679 V897G probably benign Het
Map1s G A 8: 70,913,606 R385H probably damaging Het
Map2 T C 1: 66,438,344 V1750A possibly damaging Het
Mbd1 C T 18: 74,274,721 P273L probably benign Het
Megf6 A G 4: 154,267,715 T1226A probably benign Het
Muc5ac T A 7: 141,799,289 C791S possibly damaging Het
Nlrc5 A C 8: 94,486,646 H883P probably damaging Het
Nrip3 C T 7: 109,766,570 R91H probably damaging Het
Olfr1008 A G 2: 85,689,887 T153A probably benign Het
Olfr1490 G A 19: 13,654,674 V82M probably damaging Het
Olfr530 C T 7: 140,373,076 C178Y probably damaging Het
Olfr935 A T 9: 38,994,520 I305K possibly damaging Het
Pdgfrb T G 18: 61,063,981 L163R probably damaging Het
Pik3ip1 G T 11: 3,331,945 R34L possibly damaging Het
Pip4k2b A G 11: 97,724,419 F205S possibly damaging Het
Pttg1ip A C 10: 77,589,653 N60T probably benign Het
Rab3ip C T 10: 116,914,161 E356K probably damaging Het
Rai1 A G 11: 60,185,856 N249D probably benign Het
Rd3l T C 12: 111,980,319 K8E probably damaging Het
Rnf32 A G 5: 29,203,060 K96E probably damaging Het
Rsf1 GGCG GGCGACCGCCGCG 7: 97,579,906 probably benign Het
Slc4a1ap A G 5: 31,528,130 K251E Het
Spink5 T A 18: 44,014,919 N875K probably damaging Het
Taf6 G T 5: 138,179,898 A447D probably benign Het
Tbxas1 A T 6: 39,023,055 I259F probably damaging Het
Tcap G T 11: 98,384,430 R130L probably damaging Het
Tyms T C 5: 30,061,042 E293G Het
Vmn1r20 C A 6: 57,431,774 F28L probably benign Het
Vmn2r120 A T 17: 57,524,864 D308E Het
Vmn2r69 T A 7: 85,406,969 I654F possibly damaging Het
Wrb A T 16: 96,151,939 R77W probably damaging Het
Zfp990 G T 4: 145,534,939 V52L possibly damaging Het
Other mutations in Atrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Atrn APN 2 130958079 missense probably damaging 1.00
IGL00571:Atrn APN 2 130995048 missense probably damaging 1.00
IGL01092:Atrn APN 2 130947636 nonsense probably null
IGL01572:Atrn APN 2 131002795 missense probably damaging 1.00
IGL01924:Atrn APN 2 130935565 missense probably damaging 1.00
IGL02116:Atrn APN 2 130958089 missense probably damaging 1.00
IGL02372:Atrn APN 2 131002754 splice site probably benign
IGL02390:Atrn APN 2 131020977 missense possibly damaging 0.82
IGL02548:Atrn APN 2 130972282 missense probably damaging 1.00
IGL02749:Atrn APN 2 130970144 nonsense probably null
IGL02749:Atrn APN 2 130947734 splice site probably benign
BB010:Atrn UTSW 2 130995066 missense probably damaging 1.00
BB020:Atrn UTSW 2 130995066 missense probably damaging 1.00
R0026:Atrn UTSW 2 130957920 missense probably damaging 1.00
R0403:Atrn UTSW 2 130906859 missense probably damaging 1.00
R0479:Atrn UTSW 2 130999165 nonsense probably null
R0544:Atrn UTSW 2 130986826 missense probably damaging 1.00
R0570:Atrn UTSW 2 130980134 missense probably benign 0.01
R0606:Atrn UTSW 2 130906856 missense possibly damaging 0.90
R0617:Atrn UTSW 2 130995085 critical splice donor site probably null
R0658:Atrn UTSW 2 130970227 critical splice donor site probably null
R1108:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1112:Atrn UTSW 2 130999161 missense probably benign 0.04
R1219:Atrn UTSW 2 131021007 missense possibly damaging 0.90
R1422:Atrn UTSW 2 130957914 missense probably damaging 1.00
R1524:Atrn UTSW 2 130957080 missense probably benign 0.15
R1653:Atrn UTSW 2 130935624 missense probably benign
R1795:Atrn UTSW 2 130972288 missense probably benign
R1807:Atrn UTSW 2 130982772 missense possibly damaging 0.94
R1920:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1921:Atrn UTSW 2 130995051 missense probably damaging 1.00
R1935:Atrn UTSW 2 130958035 missense probably damaging 1.00
R1982:Atrn UTSW 2 130970222 missense probably benign
R2000:Atrn UTSW 2 130935588 missense probably damaging 1.00
R2143:Atrn UTSW 2 130957996 missense probably benign 0.03
R2336:Atrn UTSW 2 130957954 missense probably damaging 1.00
R2679:Atrn UTSW 2 130961675 critical splice donor site probably null
R3426:Atrn UTSW 2 131020956 missense probably benign 0.06
R3909:Atrn UTSW 2 130994207 missense probably damaging 1.00
R4077:Atrn UTSW 2 130964930 critical splice donor site probably null
R4162:Atrn UTSW 2 130994228 splice site probably benign
R4195:Atrn UTSW 2 130933412 missense probably damaging 1.00
R4364:Atrn UTSW 2 130970208 missense probably benign 0.39
R4465:Atrn UTSW 2 130960468 missense probably benign 0.08
R4510:Atrn UTSW 2 130935577 nonsense probably null
R4511:Atrn UTSW 2 130935577 nonsense probably null
R4527:Atrn UTSW 2 130973504 missense probably benign 0.10
R4586:Atrn UTSW 2 130982042 missense probably damaging 1.00
R4592:Atrn UTSW 2 130999130 intron probably benign
R4658:Atrn UTSW 2 130933429 missense probably damaging 1.00
R4735:Atrn UTSW 2 131020990 missense probably benign 0.06
R4960:Atrn UTSW 2 130995047 nonsense probably null
R4999:Atrn UTSW 2 130975954 missense probably damaging 1.00
R5066:Atrn UTSW 2 130994193 missense possibly damaging 0.60
R5080:Atrn UTSW 2 130970124 missense possibly damaging 0.95
R5141:Atrn UTSW 2 130999130 intron probably benign
R5256:Atrn UTSW 2 130946019 missense probably benign 0.39
R5494:Atrn UTSW 2 131023075 missense probably damaging 1.00
R5678:Atrn UTSW 2 130970016 missense probably damaging 0.96
R5752:Atrn UTSW 2 130906544 unclassified probably benign
R5931:Atrn UTSW 2 130933436 missense possibly damaging 0.56
R6023:Atrn UTSW 2 131020980 missense probably benign 0.25
R6176:Atrn UTSW 2 130946091 missense probably benign 0.31
R6377:Atrn UTSW 2 130979969 missense probably damaging 1.00
R6433:Atrn UTSW 2 131023027 missense probably damaging 1.00
R7226:Atrn UTSW 2 130986744 missense probably damaging 0.99
R7402:Atrn UTSW 2 130947600 missense probably damaging 1.00
R7541:Atrn UTSW 2 130961571 missense possibly damaging 0.46
R7587:Atrn UTSW 2 130980114 missense probably damaging 1.00
R7872:Atrn UTSW 2 130970227 critical splice donor site probably null
R7910:Atrn UTSW 2 130964887 missense probably benign 0.04
R7913:Atrn UTSW 2 130970211 missense probably damaging 1.00
R7933:Atrn UTSW 2 130995066 missense probably damaging 1.00
R8044:Atrn UTSW 2 130935529 missense probably damaging 1.00
R8079:Atrn UTSW 2 131013641 missense probably null 1.00
R8093:Atrn UTSW 2 130975988 missense probably benign 0.00
R8203:Atrn UTSW 2 130960549 missense probably benign 0.00
R8234:Atrn UTSW 2 131023000 critical splice acceptor site probably null
R8462:Atrn UTSW 2 130935584 missense probably damaging 1.00
R8816:Atrn UTSW 2 130906878 missense probably damaging 1.00
R8816:Atrn UTSW 2 131004574 missense probably damaging 1.00
R8831:Atrn UTSW 2 130906601 missense probably benign 0.22
R8937:Atrn UTSW 2 130999237 missense probably benign 0.00
RF009:Atrn UTSW 2 130906922 missense probably benign 0.12
X0024:Atrn UTSW 2 130958139 missense probably damaging 1.00
Z1088:Atrn UTSW 2 130973399 missense probably benign
Z1176:Atrn UTSW 2 130946193 missense probably benign 0.27
Z1177:Atrn UTSW 2 130946042 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGCCCGTGTCTCTTTTGG -3'
(R):5'- CCATGAGATGAGTGTGACTGC -3'

Sequencing Primer
(F):5'- GGTTCCCAGGACATTTTTGATATTC -3'
(R):5'- CTGCAGAATAAAGTAAATGCAGCAC -3'
Posted On 2022-01-20