Mutagenetix > Incidental Mutation

Incidental Mutation 'R8906:Inpp5d'

695744

Institutional Source

Beutler Lab

Gene Symbol

Inpp5d

Ensembl Gene

ENSMUSG00000026288

Gene Name

inositol polyphosphate-5-phosphatase D

Synonyms

s-SHIP, SHIP, Src homology 2 domain-containing inositol-5-phosphatase, SHIP1, SHIP-1

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.894) question?

Stock #

R8906 (G1)

Quality Score

181.009

Status

Validated

Chromosome

Chromosomal Location

87620312-87720507 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to G at 87697615 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000132384 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042275] [ENSMUST00000072999] [ENSMUST00000167032] [ENSMUST00000168783] [ENSMUST00000169754] [ENSMUST00000170300]

AlphaFold

Q9ES52

Predicted Effect

probably benign
Transcript: ENSMUST00000042275

SMART Domains

Protein: ENSMUSP00000044647
Gene: ENSMUSG00000026288

Domain	Start	End	E-Value	Type
SH2	6	95	7.15e-29	SMART
low complexity region	107	120	N/A	INTRINSIC
IPPc	404	720	4.5e-104	SMART
low complexity region	767	777	N/A	INTRINSIC
low complexity region	954	979	N/A	INTRINSIC
low complexity region	1045	1057	N/A	INTRINSIC
low complexity region	1119	1131	N/A	INTRINSIC
low complexity region	1139	1148	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000072999

SMART Domains

Protein: ENSMUSP00000072763
Gene: ENSMUSG00000026288

Domain	Start	End	E-Value	Type
SH2	6	95	7.15e-29	SMART
low complexity region	107	120	N/A	INTRINSIC
IPPc	404	720	4.5e-104	SMART
low complexity region	767	777	N/A	INTRINSIC
low complexity region	932	953	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167032

SMART Domains

Protein: ENSMUSP00000126569
Gene: ENSMUSG00000026288

Domain	Start	End	E-Value	Type
IPPc	142	458	4.5e-104	SMART
low complexity region	505	515	N/A	INTRINSIC
low complexity region	692	717	N/A	INTRINSIC
low complexity region	783	795	N/A	INTRINSIC
low complexity region	857	869	N/A	INTRINSIC
low complexity region	877	886	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168783

SMART Domains

Protein: ENSMUSP00000131244
Gene: ENSMUSG00000026288

Domain	Start	End	E-Value	Type
SH2	6	95	7.15e-29	SMART
low complexity region	107	118	N/A	INTRINSIC
IPPc	405	721	4.5e-104	SMART
low complexity region	768	778	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1059	1071	N/A	INTRINSIC
low complexity region	1079	1088	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169754

SMART Domains

Protein: ENSMUSP00000127941
Gene: ENSMUSG00000026288

Domain	Start	End	E-Value	Type
SH2	6	95	4.6e-31	SMART
low complexity region	107	118	N/A	INTRINSIC
IPPc	405	721	2.2e-106	SMART
low complexity region	768	778	N/A	INTRINSIC
low complexity region	955	980	N/A	INTRINSIC
low complexity region	1046	1058	N/A	INTRINSIC
low complexity region	1120	1132	N/A	INTRINSIC
low complexity region	1140	1149	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170300

SMART Domains

Protein: ENSMUSP00000132384
Gene: ENSMUSG00000026288

Domain	Start	End	E-Value	Type
IPPc	142	458	4.5e-104	SMART
low complexity region	505	515	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	796	808	N/A	INTRINSIC
low complexity region	816	825	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (88/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the inositol polyphosphate-5-phosphatase (INPP5) family and encodes a protein with an N-terminal SH2 domain, an inositol phosphatase domain, and two C-terminal protein interaction domains. Expression of this protein is restricted to hematopoietic cells where its movement from the cytosol to the plasma membrane is mediated by tyrosine phosphorylation. At the plasma membrane, the protein hydrolyzes the 5' phosphate from phosphatidylinositol (3,4,5)-trisphosphate and inositol-1,3,4,5-tetrakisphosphate, thereby affecting multiple signaling pathways. The protein is also partly localized to the nucleus, where it may be involved in nuclear inositol phosphate signaling processes. Overall, the protein functions as a negative regulator of myeloid cell proliferation and survival. Mutations in this gene are associated with defects and cancers of the immune system. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous null mice fail to reject fully mismatched allogeneic marrow grafts, do not develop graft versus host disease, and show enhanced survival after such transplants. Homozygous splice site mutants exhibit wasting, granulocytic lung infiltration anddefective cytolysis by NK cells and CTLs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	A	C	19: 3,716,686	N91T	possibly damaging	Het
2510009E07Rik	CCGGAAGGGGAGGAGCAGTGACCCAGTTTCGGA	CCGGA	16: 21,653,398		probably null	Het
4932414N04Rik	A	G	2: 68,732,154	D375G	possibly damaging	Het
4932415D10Rik	T	C	10: 82,286,545	T3544A	probably benign	Het
Adad2	C	A	8: 119,612,986	P69Q	probably benign	Het
Adamts3	G	A	5: 89,677,716	T1088I	probably damaging	Het
Ank2	A	G	3: 126,933,071	V858A	probably benign	Het
Ankrd13a	A	G	5: 114,801,737	N475S	probably benign	Het
Barhl2	G	A	5: 106,455,486	T269I	probably benign	Het
Boc	G	A	16: 44,503,568	R157W		Het
Bsn	G	T	9: 108,107,553	P3101T	unknown	Het
Catsperb	C	A	12: 101,520,645	A477E	possibly damaging	Het
Ccser1	T	A	6: 61,810,858	I220K	probably benign	Het
Cd200r3	A	T	16: 44,957,739	I242F	possibly damaging	Het
Cdc34b	A	C	11: 94,742,085	D37A	probably damaging	Het
Chek2	A	G	5: 110,865,592		probably benign	Het
Cngb1	A	T	8: 95,263,108	V792D	probably damaging	Het
Cops7a	T	C	6: 124,962,408	K93E	possibly damaging	Het
Crispld1	T	C	1: 17,750,771	I345T	possibly damaging	Het
Dgkd	A	G	1: 87,941,435	D1170G	probably damaging	Het
Dhx35	A	G	2: 158,806,998	T115A	possibly damaging	Het
Dnaic1	G	A	4: 41,625,125	R363H	probably benign	Het
Dnmbp	T	A	19: 43,890,242	Q130L	probably benign	Het
Egfr	A	G	11: 16,911,635	Y1138C	probably damaging	Het
Elf3	A	T	1: 135,254,940	L329Q	probably damaging	Het
Enkur	A	G	2: 21,196,757	M39T	probably benign	Het
Epha7	T	C	4: 28,821,615	I260T	probably damaging	Het
Fbxo28	A	T	1: 182,317,069	I310K	probably damaging	Het
Fga	C	A	3: 83,031,804	N495K	probably benign	Het
Galnt6	T	C	15: 100,703,366	D344G	probably damaging	Het
Gm572	A	G	4: 148,666,833	Q221R	probably benign	Het
Gm6205	G	T	5: 94,683,554	R140L	possibly damaging	Het
Gpa33	G	A	1: 166,146,647	A18T	probably benign	Het
Gpatch11	C	T	17: 78,837,860	T6I	probably benign	Het
Gpr84	T	A	15: 103,309,198	S151C	probably damaging	Het
H2-M11	T	A	17: 36,548,959	Y281*	probably null	Het
Hadh	T	C	3: 131,245,242	N155S	probably benign	Het
Hoxd13	A	G	2: 74,669,922	Y269C		Het
Iars	T	A	13: 49,728,701	C1074S	probably benign	Het
Ibtk	G	T	9: 85,743,404	H98N	possibly damaging	Het
Igsf10	C	T	3: 59,326,318	G1665R	probably benign	Het
Ipo9	A	C	1: 135,394,213	V593G	probably damaging	Het
Irx3	T	C	8: 91,800,287	D263G	possibly damaging	Het
Kif13a	A	G	13: 46,773,678	V1179A	probably benign	Het
Lrrc4c	T	C	2: 97,630,048	Y340H	probably benign	Het
Lysmd1	A	G	3: 95,137,908	D155G	probably damaging	Het
Micalcl	T	A	7: 112,381,464	I105N	probably damaging	Het
Mob2	A	T	7: 142,009,524	L66Q	probably damaging	Het
Myh1	A	G	11: 67,205,913	S337G	probably benign	Het
Neb	T	C	2: 52,206,247	D1002G	probably benign	Het
Nebl	A	T	2: 17,378,117	N116K	probably benign	Het
Nkx2-6	T	C	14: 69,175,174	S264P	probably benign	Het
Nlgn3	T	C	X: 101,308,784	V179A	probably damaging	Het
Nlrp4e	A	G	7: 23,321,131	T348A	possibly damaging	Het
Nomo1	A	T	7: 46,072,580	I982F	probably benign	Het
Olfr16	A	G	1: 172,956,619		probably benign	Het
Olfr348	A	T	2: 36,786,609	Y28F	probably benign	Het
Olfr739	T	G	14: 50,424,834	F105C	probably damaging	Het
Olfr936	A	G	9: 39,046,781	F213L	possibly damaging	Het
Palld	A	G	8: 61,550,164		probably null	Het
Pcdh7	A	G	5: 57,721,812	Y903C	probably damaging	Het
Pknox2	G	A	9: 36,892,871	T460M	possibly damaging	Het
Ppm1h	C	T	10: 122,878,546	T330I	probably damaging	Het
Ppp2r2b	C	T	18: 42,688,334	R253H	probably damaging	Het
Prr18	G	A	17: 8,341,644	A211T	probably benign	Het
Ptgs2	A	G	1: 150,104,108	I321M		Het
Rara	G	T	11: 98,970,163	R159L	probably damaging	Het
Rasa4	T	A	5: 136,104,592	I635N	probably benign	Het
Rxfp2	A	T	5: 150,066,423	H423L	possibly damaging	Het
Scn4b	A	G	9: 45,147,871	I147V	possibly damaging	Het
Scrn3	G	A	2: 73,331,008	V313I	probably benign	Het
Scrn3	C	A	2: 73,331,011	P314T	possibly damaging	Het
Sh2b1	A	G	7: 126,471,120		probably null	Het
Slc26a10	T	C	10: 127,180,590	Q3R	probably benign	Het
Slitrk1	A	G	14: 108,911,707	I524T	probably damaging	Het
Smcp	T	A	3: 92,584,223	N106Y	unknown	Het
St8sia5	G	A	18: 77,248,476	V202M	probably damaging	Het
Stxbp5l	A	T	16: 37,208,164	D512E	probably damaging	Het
Tas1r2	A	G	4: 139,669,735	E795G	probably damaging	Het
Tdrd1	T	A	19: 56,842,713	V320D	probably damaging	Het
Tmem71	T	A	15: 66,532,757	I261L	probably benign	Het
Tns2	T	C	15: 102,111,604	L643P	probably damaging	Het
Upf1	G	A	8: 70,334,165	Q890*	probably null	Het
Usp43	A	T	11: 67,891,481	H370Q	possibly damaging	Het
Vmn1r236	T	A	17: 21,287,094	I158N	possibly damaging	Het
Vmn2r98	T	A	17: 19,066,270	N343K	probably benign	Het
Vwa8	T	C	14: 79,092,375	S1216P	probably benign	Het
Yars	A	C	4: 129,196,954	D97A	probably damaging	Het
Zer1	G	A	2: 30,111,023	H129Y	probably benign	Het
Zfat	C	T	15: 68,084,555	D1143N	possibly damaging	Het

Other mutations in Inpp5d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Inpp5d	APN	1	87683815	missense	probably benign	0.00
IGL00329:Inpp5d	APN	1	87668003	missense	probably benign	0.00
IGL00897:Inpp5d	APN	1	87712114	missense	probably benign	0.14
IGL01314:Inpp5d	APN	1	87683750	nonsense	probably null
IGL02145:Inpp5d	APN	1	87715055	missense	probably damaging	1.00
IGL02422:Inpp5d	APN	1	87708132	missense	probably damaging	1.00
IGL02538:Inpp5d	APN	1	87695366	missense	probably null	0.92
IGL02680:Inpp5d	APN	1	87701483	missense	possibly damaging	0.87
IGL03083:Inpp5d	APN	1	87711141	missense	probably damaging	1.00
IGL03308:Inpp5d	APN	1	87703197	missense	probably damaging	1.00
americas	UTSW	1	87715142	missense	probably damaging	1.00
Apfelsine	UTSW	1	87683845	nonsense	probably null
Auburn	UTSW	1	87681680	splice site	probably null
Autumnal	UTSW	1	87691711	missense	probably damaging	0.97
Gourd	UTSW	1	87697615	intron	probably benign
lyda	UTSW	1	87683762	missense	probably damaging	1.00
Mandarin	UTSW	1	87709626	missense	probably damaging	0.99
naranjo	UTSW	1	87708211	critical splice donor site	probably null
New_black	UTSW	1	87709675	missense	probably damaging	1.00
Orange	UTSW	1	87697546	critical splice donor site	probably null
pantone	UTSW	1	87699675	missense	probably damaging	1.00
sailing	UTSW	1	87705964	missense	probably damaging	1.00
Salamander	UTSW	1	87695380	missense	probably damaging	0.99
Sandstone	UTSW	1	87695400	missense	probably damaging	1.00
styx	UTSW	1	87669784	critical splice donor site	probably benign
tangerine	UTSW	1	87705949	missense	probably damaging	1.00
ulster	UTSW	1	87701476	nonsense	probably null
R0010:Inpp5d	UTSW	1	87697546	critical splice donor site	probably null
R0037:Inpp5d	UTSW	1	87708129	missense	probably damaging	0.99
R0087:Inpp5d	UTSW	1	87715138	missense	probably damaging	1.00
R0492:Inpp5d	UTSW	1	87698150	missense	possibly damaging	0.94
R0520:Inpp5d	UTSW	1	87705920	splice site	probably benign
R0733:Inpp5d	UTSW	1	87668077	splice site	probably benign
R1464:Inpp5d	UTSW	1	87698105	splice site	probably benign
R1576:Inpp5d	UTSW	1	87669685	missense	probably benign	0.16
R1576:Inpp5d	UTSW	1	87681558	missense	probably damaging	0.96
R1592:Inpp5d	UTSW	1	87665532	missense	possibly damaging	0.90
R1750:Inpp5d	UTSW	1	87699081	missense	probably damaging	1.00
R1774:Inpp5d	UTSW	1	87667889	missense	probably benign	0.30
R1972:Inpp5d	UTSW	1	87676314	missense	probably benign	0.00
R2024:Inpp5d	UTSW	1	87695350	nonsense	probably null
R2405:Inpp5d	UTSW	1	87699729	missense	possibly damaging	0.94
R3412:Inpp5d	UTSW	1	87668057	missense	possibly damaging	0.93
R3414:Inpp5d	UTSW	1	87668057	missense	possibly damaging	0.93
R3756:Inpp5d	UTSW	1	87701408	splice site	probably benign
R4652:Inpp5d	UTSW	1	87665451	missense	probably benign	0.03
R4676:Inpp5d	UTSW	1	87715142	missense	probably damaging	1.00
R4834:Inpp5d	UTSW	1	87697523	missense	possibly damaging	0.52
R5086:Inpp5d	UTSW	1	87705964	missense	probably damaging	1.00
R5159:Inpp5d	UTSW	1	87676342	missense	probably damaging	1.00
R5250:Inpp5d	UTSW	1	87709675	missense	probably damaging	1.00
R5442:Inpp5d	UTSW	1	87718066	missense	probably benign	0.02
R5875:Inpp5d	UTSW	1	87717974	missense	possibly damaging	0.47
R6135:Inpp5d	UTSW	1	87620397	splice site	probably null
R6371:Inpp5d	UTSW	1	87699675	missense	probably damaging	1.00
R6385:Inpp5d	UTSW	1	87699675	missense	probably damaging	1.00
R6386:Inpp5d	UTSW	1	87699675	missense	probably damaging	1.00
R6526:Inpp5d	UTSW	1	87676250	start gained	probably benign
R6572:Inpp5d	UTSW	1	87695396	missense	probably damaging	0.99
R6831:Inpp5d	UTSW	1	87701476	nonsense	probably null
R6853:Inpp5d	UTSW	1	87681680	splice site	probably null
R6883:Inpp5d	UTSW	1	87699690	missense	probably damaging	0.98
R7082:Inpp5d	UTSW	1	87695380	missense	probably damaging	0.99
R7215:Inpp5d	UTSW	1	87701218	missense	probably benign	0.30
R7418:Inpp5d	UTSW	1	87708211	critical splice donor site	probably null
R7471:Inpp5d	UTSW	1	87695400	missense	probably damaging	1.00
R7593:Inpp5d	UTSW	1	87717778	missense	possibly damaging	0.82
R7716:Inpp5d	UTSW	1	87665399	missense	probably damaging	0.97
R7781:Inpp5d	UTSW	1	87699672	missense	probably damaging	1.00
R7808:Inpp5d	UTSW	1	87683845	nonsense	probably null
R7920:Inpp5d	UTSW	1	87705949	missense	probably damaging	1.00
R8788:Inpp5d	UTSW	1	87683762	missense	probably damaging	1.00
R8839:Inpp5d	UTSW	1	87691711	missense	probably damaging	0.97
R8905:Inpp5d	UTSW	1	87709626	missense	probably damaging	0.99
R9517:Inpp5d	UTSW	1	87711131	missense	probably benign	0.01
R9667:Inpp5d	UTSW	1	87695406	missense	probably damaging	1.00
R9716:Inpp5d	UTSW	1	87697469	missense	possibly damaging	0.90
Z1176:Inpp5d	UTSW	1	87669709	missense	probably benign	0.16
Z1176:Inpp5d	UTSW	1	87703131	missense	probably damaging	1.00
Z1191:Inpp5d	UTSW	1	87683770	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GACTCTGCTGACTACATCCC -3'
(R):5'- TGGGACTGAAAATGCATCTAGG -3'

Sequencing Primer
(F):5'- CCCATGACATCTATGTGATTGGC -3'
(R):5'- CCTGGAATTCACTTTGTAGACCAGG -3'

Posted On

2022-01-31