Incidental Mutation 'R9163:Vmn2r23'
ID 695836
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Name vomeronasal 2, receptor 23
Synonyms EG435916
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R9163 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 123702821-123742291 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 123741823 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 712 (C712S)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect probably damaging
Transcript: ENSMUST00000172391
AA Change: C712S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: C712S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,245,281 S351P possibly damaging Het
4930558K02Rik A G 1: 161,949,605 S128P probably benign Het
Adam17 C T 12: 21,351,587 V136I probably benign Het
Adam19 A G 11: 46,127,349 T413A probably benign Het
Adam28 T C 14: 68,629,082 K443E probably damaging Het
Adgrv1 T A 13: 81,419,422 T5211S probably benign Het
Adnp2 A T 18: 80,128,985 N736K possibly damaging Het
Agtpbp1 C T 13: 59,462,070 W1082* probably null Het
Ap3b2 T G 7: 81,463,798 M888L unknown Het
Arhgap35 C A 7: 16,561,624 R1172L possibly damaging Het
Arrdc3 T A 13: 80,893,387 D402E probably benign Het
Ccdc14 T C 16: 34,690,748 F31L possibly damaging Het
Ccdc173 A T 2: 69,776,166 I302K probably benign Het
Cd5l T G 3: 87,367,625 L157R probably benign Het
Cdc14a G T 3: 116,328,564 D251E possibly damaging Het
Chmp2a T A 7: 13,032,718 Q91L possibly damaging Het
Col12a1 A G 9: 79,641,447 probably null Het
Ctdsp1 G T 1: 74,394,967 R201L possibly damaging Het
Dhx15 C T 5: 52,184,856 R40H probably damaging Het
Dnph1 A G 17: 46,498,934 Y134C probably damaging Het
Foxo1 T A 3: 52,345,880 V488D probably benign Het
Gcn1l1 C A 5: 115,604,885 N1538K probably benign Het
Gldc T A 19: 30,134,286 E500V probably benign Het
Hhip G A 8: 79,975,114 T597I probably benign Het
Hmgn1 A G 16: 96,127,309 probably null Het
Ifi205 A T 1: 174,017,422 S265T possibly damaging Het
Igkv1-131 T C 6: 67,766,769 M2V probably benign Het
Irgm2 T G 11: 58,220,454 S324A probably damaging Het
Jarid2 C G 13: 44,911,251 D937E possibly damaging Het
Jrkl A T 9: 13,245,399 W86R probably damaging Het
Kbtbd3 A G 9: 4,330,584 I319M probably benign Het
Klhl7 T C 5: 24,159,467 Y500H probably damaging Het
Lats1 C T 10: 7,702,288 A392V probably benign Het
Llgl1 G T 11: 60,709,576 A584S probably benign Het
Macf1 G T 4: 123,509,893 S560Y probably damaging Het
Olfr1206 C T 2: 88,865,451 P282L possibly damaging Het
Olfr250 T A 9: 38,368,082 C169S probably damaging Het
Pde10a G A 17: 8,962,959 C498Y possibly damaging Het
Pde4dip A G 3: 97,751,807 probably null Het
Pdhx G A 2: 103,022,216 P434L probably damaging Het
Pdlim3 T C 8: 45,885,674 probably null Het
Pik3c3 T C 18: 30,294,430 probably null Het
Prkag1 T C 15: 98,814,019 K242R possibly damaging Het
Rap1b A G 10: 117,818,486 S150P possibly damaging Het
Scn4a A G 11: 106,326,250 S1102P probably damaging Het
Scrib A G 15: 76,049,259 Y1332H probably damaging Het
Sim1 A G 10: 50,896,069 E58G probably benign Het
Slc13a1 C T 6: 24,097,579 probably null Het
Slc17a8 A G 10: 89,589,582 V380A probably damaging Het
Slc5a4b G T 10: 76,081,331 Y290* probably null Het
Slco4c1 A G 1: 96,836,908 F480L probably damaging Het
Srcap T C 7: 127,521,990 V146A unknown Het
Ssc5d T A 7: 4,933,433 D559E probably damaging Het
Sstr5 A C 17: 25,491,610 I215S probably damaging Het
Stambpl1 G A 19: 34,235,234 C268Y probably benign Het
Stard3nl C A 13: 19,376,639 probably benign Het
Sycp3 T C 10: 88,463,872 probably null Het
Syne2 A T 12: 75,962,575 M2417L possibly damaging Het
Tenm4 T G 7: 96,823,873 Y959D probably damaging Het
Tmem132d T A 5: 127,792,506 D588V possibly damaging Het
Tnfrsf26 T C 7: 143,618,393 E60G possibly damaging Het
Topbp1 A G 9: 103,328,568 R802G probably benign Het
Trmu T C 15: 85,896,895 V360A probably benign Het
Tshz2 G A 2: 169,884,642 C386Y probably damaging Het
Ttn A T 2: 76,870,427 D61E Het
Upf1 T C 8: 70,340,024 T345A probably benign Het
Vmn2r44 C T 7: 8,368,092 V652I probably benign Het
Wfdc1 T C 8: 119,666,563 V8A probably benign Het
Xrn1 A G 9: 95,998,221 Y738C probably benign Het
Zfp618 T G 4: 63,133,274 V764G probably damaging Het
Znfx1 A T 2: 167,056,341 M221K probably damaging Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123729725 missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123729596 missense probably benign
IGL01073:Vmn2r23 APN 6 123712800 missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123704424 missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123704407 missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123741886 missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123741860 missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123741744 missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123741836 missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123704478 missense probably benign
IGL02831:Vmn2r23 APN 6 123704385 missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123704396 missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123741619 missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123741782 missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123704374 missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123729626 missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123729721 missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123742135 missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123742004 missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123713270 nonsense probably null
R1629:Vmn2r23 UTSW 6 123713427 missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123729690 missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123702915 missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123713010 missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123741499 missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123704425 missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123742188 nonsense probably null
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123713170 missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123741389 missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123729738 missense probably benign
R4506:Vmn2r23 UTSW 6 123702925 missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123741730 missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123741826 missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123733349 missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123713002 missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123733273 missense probably benign
R5761:Vmn2r23 UTSW 6 123712759 missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123733393 missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123712942 missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123741895 missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123704400 missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123712902 missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123713425 missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123733273 missense probably benign
R6925:Vmn2r23 UTSW 6 123704553 missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123713022 missense probably benign
R7215:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123741581 missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123704579 missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123704541 missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123741353 missense probably damaging 0.99
R8474:Vmn2r23 UTSW 6 123704640 missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123741656 missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123713472 missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123703032 missense
R8966:Vmn2r23 UTSW 6 123742120 missense possibly damaging 0.94
R9124:Vmn2r23 UTSW 6 123742079 missense possibly damaging 0.57
R9189:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R9451:Vmn2r23 UTSW 6 123733393 missense probably damaging 1.00
RF018:Vmn2r23 UTSW 6 123713116 missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123713161 missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123742108 missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123729725 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AATATTCATTGGCCAACCTGGAAC -3'
(R):5'- TGTCAGGTAGCCTTCTCACCAG -3'

Sequencing Primer
(F):5'- GAACAGTCACTTGTGTCTTGAGAC -3'
(R):5'- GGTAGCCTTCTCACCAGAAAAG -3'
Posted On 2022-02-07