Incidental Mutation 'R9163:Adam19'
ID 695861
Institutional Source Beutler Lab
Gene Symbol Adam19
Ensembl Gene ENSMUSG00000011256
Gene Name a disintegrin and metallopeptidase domain 19 (meltrin beta)
Synonyms Mltnb
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9163 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 46055992-46147343 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46127349 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 413 (T413A)
Ref Sequence ENSEMBL: ENSMUSP00000011400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011400]
AlphaFold O35674
Predicted Effect probably benign
Transcript: ENSMUST00000011400
AA Change: T413A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000011400
Gene: ENSMUSG00000011256
AA Change: T413A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pep_M12B_propep 32 163 9.4e-27 PFAM
Pfam:Reprolysin_5 209 388 1.9e-25 PFAM
Pfam:Reprolysin_4 209 399 1.5e-15 PFAM
Pfam:Reprolysin 211 409 1.3e-68 PFAM
Pfam:Reprolysin_2 231 399 6.1e-19 PFAM
Pfam:Reprolysin_3 235 357 1.2e-19 PFAM
DISIN 426 501 9.7e-41 SMART
ACR 502 650 7.46e-62 SMART
transmembrane domain 704 726 N/A INTRINSIC
low complexity region 788 797 N/A INTRINSIC
low complexity region 832 846 N/A INTRINSIC
low complexity region 886 905 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: This gene encodes a cell surface glycoprotein and member of the ADAM (a disintegrin and metalloproteinase) family of endopeptidases. The encoded protein may play a role in the ectodomain shedding of neuregulin proteins. Homozygous knockout mice for this gene exhibit heart development defects and perinatal lethality. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that undergoes proteolytic processing to generate a mature protein product. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice exhibit cardiac developmental defects and die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,245,281 S351P possibly damaging Het
4930558K02Rik A G 1: 161,949,605 S128P probably benign Het
Adam17 C T 12: 21,351,587 V136I probably benign Het
Adam28 T C 14: 68,629,082 K443E probably damaging Het
Adgrv1 T A 13: 81,419,422 T5211S probably benign Het
Adnp2 A T 18: 80,128,985 N736K possibly damaging Het
Agtpbp1 C T 13: 59,462,070 W1082* probably null Het
Ap3b2 T G 7: 81,463,798 M888L unknown Het
Arhgap35 C A 7: 16,561,624 R1172L possibly damaging Het
Arrdc3 T A 13: 80,893,387 D402E probably benign Het
Ccdc14 T C 16: 34,690,748 F31L possibly damaging Het
Ccdc173 A T 2: 69,776,166 I302K probably benign Het
Cd5l T G 3: 87,367,625 L157R probably benign Het
Cdc14a G T 3: 116,328,564 D251E possibly damaging Het
Chmp2a T A 7: 13,032,718 Q91L possibly damaging Het
Col12a1 A G 9: 79,641,447 probably null Het
Ctdsp1 G T 1: 74,394,967 R201L possibly damaging Het
Dhx15 C T 5: 52,184,856 R40H probably damaging Het
Dnph1 A G 17: 46,498,934 Y134C probably damaging Het
Foxo1 T A 3: 52,345,880 V488D probably benign Het
Gcn1l1 C A 5: 115,604,885 N1538K probably benign Het
Gldc T A 19: 30,134,286 E500V probably benign Het
Hhip G A 8: 79,975,114 T597I probably benign Het
Hmgn1 A G 16: 96,127,309 probably null Het
Ifi205 A T 1: 174,017,422 S265T possibly damaging Het
Igkv1-131 T C 6: 67,766,769 M2V probably benign Het
Irgm2 T G 11: 58,220,454 S324A probably damaging Het
Jarid2 C G 13: 44,911,251 D937E possibly damaging Het
Jrkl A T 9: 13,245,399 W86R probably damaging Het
Kbtbd3 A G 9: 4,330,584 I319M probably benign Het
Klhl7 T C 5: 24,159,467 Y500H probably damaging Het
Lats1 C T 10: 7,702,288 A392V probably benign Het
Llgl1 G T 11: 60,709,576 A584S probably benign Het
Macf1 G T 4: 123,509,893 S560Y probably damaging Het
Olfr1206 C T 2: 88,865,451 P282L possibly damaging Het
Olfr250 T A 9: 38,368,082 C169S probably damaging Het
Pde10a G A 17: 8,962,959 C498Y possibly damaging Het
Pde4dip A G 3: 97,751,807 probably null Het
Pdhx G A 2: 103,022,216 P434L probably damaging Het
Pdlim3 T C 8: 45,885,674 probably null Het
Pik3c3 T C 18: 30,294,430 probably null Het
Prkag1 T C 15: 98,814,019 K242R possibly damaging Het
Rap1b A G 10: 117,818,486 S150P possibly damaging Het
Scn4a A G 11: 106,326,250 S1102P probably damaging Het
Scrib A G 15: 76,049,259 Y1332H probably damaging Het
Sim1 A G 10: 50,896,069 E58G probably benign Het
Slc13a1 C T 6: 24,097,579 probably null Het
Slc17a8 A G 10: 89,589,582 V380A probably damaging Het
Slc5a4b G T 10: 76,081,331 Y290* probably null Het
Slco4c1 A G 1: 96,836,908 F480L probably damaging Het
Srcap T C 7: 127,521,990 V146A unknown Het
Ssc5d T A 7: 4,933,433 D559E probably damaging Het
Sstr5 A C 17: 25,491,610 I215S probably damaging Het
Stambpl1 G A 19: 34,235,234 C268Y probably benign Het
Stard3nl C A 13: 19,376,639 probably benign Het
Sycp3 T C 10: 88,463,872 probably null Het
Syne2 A T 12: 75,962,575 M2417L possibly damaging Het
Tenm4 T G 7: 96,823,873 Y959D probably damaging Het
Tmem132d T A 5: 127,792,506 D588V possibly damaging Het
Tnfrsf26 T C 7: 143,618,393 E60G possibly damaging Het
Topbp1 A G 9: 103,328,568 R802G probably benign Het
Trmu T C 15: 85,896,895 V360A probably benign Het
Tshz2 G A 2: 169,884,642 C386Y probably damaging Het
Ttn A T 2: 76,870,427 D61E Het
Upf1 T C 8: 70,340,024 T345A probably benign Het
Vmn2r23 T A 6: 123,741,823 C712S probably damaging Het
Vmn2r44 C T 7: 8,368,092 V652I probably benign Het
Wfdc1 T C 8: 119,666,563 V8A probably benign Het
Xrn1 A G 9: 95,998,221 Y738C probably benign Het
Zfp618 T G 4: 63,133,274 V764G probably damaging Het
Znfx1 A T 2: 167,056,341 M221K probably damaging Het
Other mutations in Adam19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Adam19 APN 11 46112783 missense probably damaging 1.00
IGL01727:Adam19 APN 11 46121553 missense probably benign
IGL01758:Adam19 APN 11 46112924 missense probably benign 0.01
IGL02160:Adam19 APN 11 46139695 missense probably damaging 0.99
IGL02421:Adam19 APN 11 46137553 missense probably damaging 0.96
IGL02572:Adam19 APN 11 46131721 nonsense probably null
IGL02995:Adam19 APN 11 46136349 missense probably benign 0.00
IGL03171:Adam19 APN 11 46138854 missense probably damaging 0.98
IGL03237:Adam19 APN 11 46137556 missense probably benign
R0003:Adam19 UTSW 11 46128789 missense probably damaging 1.00
R0026:Adam19 UTSW 11 46136259 missense probably damaging 1.00
R0158:Adam19 UTSW 11 46143034 missense probably damaging 1.00
R0304:Adam19 UTSW 11 46127392 missense possibly damaging 0.91
R0488:Adam19 UTSW 11 46138930 missense probably damaging 0.98
R0501:Adam19 UTSW 11 46123130 missense probably damaging 1.00
R0591:Adam19 UTSW 11 46121411 splice site probably benign
R0734:Adam19 UTSW 11 46127403 missense probably damaging 0.99
R0747:Adam19 UTSW 11 46118495 splice site probably null
R0771:Adam19 UTSW 11 46121453 missense possibly damaging 0.92
R1052:Adam19 UTSW 11 46127265 missense probably damaging 0.99
R1573:Adam19 UTSW 11 46113618 splice site probably benign
R1735:Adam19 UTSW 11 46138917 missense probably benign 0.26
R1830:Adam19 UTSW 11 46127278 missense probably damaging 0.98
R1911:Adam19 UTSW 11 46121454 missense probably damaging 1.00
R2092:Adam19 UTSW 11 46060904 splice site probably null
R3749:Adam19 UTSW 11 46137610 missense probably benign 0.00
R3893:Adam19 UTSW 11 46128838 missense probably damaging 1.00
R3916:Adam19 UTSW 11 46060935 missense probably benign 0.25
R3917:Adam19 UTSW 11 46060935 missense probably benign 0.25
R4506:Adam19 UTSW 11 46118444 missense possibly damaging 0.67
R4767:Adam19 UTSW 11 46138977 critical splice donor site probably null
R5055:Adam19 UTSW 11 46123169 missense probably damaging 1.00
R5313:Adam19 UTSW 11 46131776 missense probably damaging 1.00
R5329:Adam19 UTSW 11 46125026 missense probably damaging 0.99
R5567:Adam19 UTSW 11 46136250 missense probably damaging 1.00
R5602:Adam19 UTSW 11 46136315 missense probably benign
R6198:Adam19 UTSW 11 46121502 missense probably damaging 1.00
R6875:Adam19 UTSW 11 46112875 missense probably benign
R7011:Adam19 UTSW 11 46143018 missense probably benign 0.00
R7163:Adam19 UTSW 11 46131717 missense probably benign
R7213:Adam19 UTSW 11 46121471 missense probably benign 0.20
R7267:Adam19 UTSW 11 46121576 nonsense probably null
R7896:Adam19 UTSW 11 46137543 missense probably damaging 1.00
R8012:Adam19 UTSW 11 46065046 missense possibly damaging 0.74
R8059:Adam19 UTSW 11 46136466 splice site probably benign
R8243:Adam19 UTSW 11 46125082 missense probably damaging 1.00
R8357:Adam19 UTSW 11 46140112 missense probably damaging 0.96
R8419:Adam19 UTSW 11 46125023 missense possibly damaging 0.77
R8457:Adam19 UTSW 11 46140112 missense probably damaging 0.96
R9349:Adam19 UTSW 11 46131743 nonsense probably null
R9489:Adam19 UTSW 11 46137622 missense probably benign 0.10
R9579:Adam19 UTSW 11 46118435 missense probably benign 0.00
X0067:Adam19 UTSW 11 46056115 start codon destroyed probably null 0.06
Predicted Primers PCR Primer
(F):5'- TCATCCAAGTGAACTAAGCCTC -3'
(R):5'- TCCTTTCCATAGGAAGGACCG -3'

Sequencing Primer
(F):5'- CCAAGTGAACTAAGCCTCTTGAGTG -3'
(R):5'- CTTTCCATAGGAAGGACCGCATTG -3'
Posted On 2022-02-07