Incidental Mutation 'R9163:Pde10a'
ID 695879
Institutional Source Beutler Lab
Gene Symbol Pde10a
Ensembl Gene ENSMUSG00000023868
Gene Name phosphodiesterase 10A
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9163 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 8525372-8986648 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 8962959 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 498 (C498Y)
Ref Sequence ENSEMBL: ENSMUSP00000086485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024647] [ENSMUST00000089085] [ENSMUST00000115708] [ENSMUST00000115715] [ENSMUST00000115717] [ENSMUST00000115720] [ENSMUST00000115724] [ENSMUST00000149440] [ENSMUST00000231430]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000024647
AA Change: C418Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000024647
Gene: ENSMUSG00000023868
AA Change: C418Y

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000089085
AA Change: C498Y

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086485
Gene: ENSMUSG00000023868
AA Change: C498Y

DomainStartEndE-ValueType
GAF 101 254 1.44e-3 SMART
GAF 276 432 6.56e-29 SMART
HDc 522 688 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115708
AA Change: C214Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111373
Gene: ENSMUSG00000023868
AA Change: C214Y

DomainStartEndE-ValueType
GAF 3 148 5.22e-23 SMART
HDc 238 404 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115715
AA Change: C418Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111380
Gene: ENSMUSG00000023868
AA Change: C418Y

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115717
Predicted Effect possibly damaging
Transcript: ENSMUST00000115720
AA Change: C481Y

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111385
Gene: ENSMUSG00000023868
AA Change: C481Y

DomainStartEndE-ValueType
GAF 84 237 1.44e-3 SMART
GAF 259 415 6.56e-29 SMART
HDc 505 671 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115724
AA Change: C552Y

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111389
Gene: ENSMUSG00000023868
AA Change: C552Y

DomainStartEndE-ValueType
GAF 95 248 1.44e-3 SMART
GAF 270 426 6.56e-29 SMART
HDc 516 682 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000149440
AA Change: C429Y

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123216
Gene: ENSMUSG00000023868
AA Change: C429Y

DomainStartEndE-ValueType
GAF 32 185 1.44e-3 SMART
GAF 207 363 6.56e-29 SMART
HDc 453 619 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000231430
AA Change: C780Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in decreased exploratory behavior, hypoactivity, and a delay in the acquisition of conditioned avoidance behavior. A hypomorphic allele results in increased social behavior. Mice homozygous for a knock-out allele exhibit resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,245,281 S351P possibly damaging Het
4930558K02Rik A G 1: 161,949,605 S128P probably benign Het
Adam17 C T 12: 21,351,587 V136I probably benign Het
Adam19 A G 11: 46,127,349 T413A probably benign Het
Adam28 T C 14: 68,629,082 K443E probably damaging Het
Adgrv1 T A 13: 81,419,422 T5211S probably benign Het
Adnp2 A T 18: 80,128,985 N736K possibly damaging Het
Agtpbp1 C T 13: 59,462,070 W1082* probably null Het
Ap3b2 T G 7: 81,463,798 M888L unknown Het
Arhgap35 C A 7: 16,561,624 R1172L possibly damaging Het
Arrdc3 T A 13: 80,893,387 D402E probably benign Het
Ccdc14 T C 16: 34,690,748 F31L possibly damaging Het
Ccdc173 A T 2: 69,776,166 I302K probably benign Het
Cd5l T G 3: 87,367,625 L157R probably benign Het
Cdc14a G T 3: 116,328,564 D251E possibly damaging Het
Chmp2a T A 7: 13,032,718 Q91L possibly damaging Het
Col12a1 A G 9: 79,641,447 probably null Het
Ctdsp1 G T 1: 74,394,967 R201L possibly damaging Het
Dhx15 C T 5: 52,184,856 R40H probably damaging Het
Dnph1 A G 17: 46,498,934 Y134C probably damaging Het
Foxo1 T A 3: 52,345,880 V488D probably benign Het
Gcn1l1 C A 5: 115,604,885 N1538K probably benign Het
Gldc T A 19: 30,134,286 E500V probably benign Het
Hhip G A 8: 79,975,114 T597I probably benign Het
Hmgn1 A G 16: 96,127,309 probably null Het
Ifi205 A T 1: 174,017,422 S265T possibly damaging Het
Igkv1-131 T C 6: 67,766,769 M2V probably benign Het
Irgm2 T G 11: 58,220,454 S324A probably damaging Het
Jarid2 C G 13: 44,911,251 D937E possibly damaging Het
Jrkl A T 9: 13,245,399 W86R probably damaging Het
Kbtbd3 A G 9: 4,330,584 I319M probably benign Het
Klhl7 T C 5: 24,159,467 Y500H probably damaging Het
Lats1 C T 10: 7,702,288 A392V probably benign Het
Llgl1 G T 11: 60,709,576 A584S probably benign Het
Macf1 G T 4: 123,509,893 S560Y probably damaging Het
Olfr1206 C T 2: 88,865,451 P282L possibly damaging Het
Olfr250 T A 9: 38,368,082 C169S probably damaging Het
Pde4dip A G 3: 97,751,807 probably null Het
Pdhx G A 2: 103,022,216 P434L probably damaging Het
Pdlim3 T C 8: 45,885,674 probably null Het
Pik3c3 T C 18: 30,294,430 probably null Het
Prkag1 T C 15: 98,814,019 K242R possibly damaging Het
Rap1b A G 10: 117,818,486 S150P possibly damaging Het
Scn4a A G 11: 106,326,250 S1102P probably damaging Het
Scrib A G 15: 76,049,259 Y1332H probably damaging Het
Sim1 A G 10: 50,896,069 E58G probably benign Het
Slc13a1 C T 6: 24,097,579 probably null Het
Slc17a8 A G 10: 89,589,582 V380A probably damaging Het
Slc5a4b G T 10: 76,081,331 Y290* probably null Het
Slco4c1 A G 1: 96,836,908 F480L probably damaging Het
Srcap T C 7: 127,521,990 V146A unknown Het
Ssc5d T A 7: 4,933,433 D559E probably damaging Het
Sstr5 A C 17: 25,491,610 I215S probably damaging Het
Stambpl1 G A 19: 34,235,234 C268Y probably benign Het
Stard3nl C A 13: 19,376,639 probably benign Het
Sycp3 T C 10: 88,463,872 probably null Het
Syne2 A T 12: 75,962,575 M2417L possibly damaging Het
Tenm4 T G 7: 96,823,873 Y959D probably damaging Het
Tmem132d T A 5: 127,792,506 D588V possibly damaging Het
Tnfrsf26 T C 7: 143,618,393 E60G possibly damaging Het
Topbp1 A G 9: 103,328,568 R802G probably benign Het
Trmu T C 15: 85,896,895 V360A probably benign Het
Tshz2 G A 2: 169,884,642 C386Y probably damaging Het
Ttn A T 2: 76,870,427 D61E Het
Upf1 T C 8: 70,340,024 T345A probably benign Het
Vmn2r23 T A 6: 123,741,823 C712S probably damaging Het
Vmn2r44 C T 7: 8,368,092 V652I probably benign Het
Wfdc1 T C 8: 119,666,563 V8A probably benign Het
Xrn1 A G 9: 95,998,221 Y738C probably benign Het
Zfp618 T G 4: 63,133,274 V764G probably damaging Het
Znfx1 A T 2: 167,056,341 M221K probably damaging Het
Other mutations in Pde10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Pde10a APN 17 8944970 missense probably damaging 1.00
IGL01762:Pde10a APN 17 8942918 missense possibly damaging 0.74
IGL01814:Pde10a APN 17 8929107 start codon destroyed probably null 0.00
IGL02053:Pde10a APN 17 8974769 missense probably damaging 1.00
IGL02386:Pde10a APN 17 8953804 missense possibly damaging 0.93
IGL02573:Pde10a APN 17 8961890 missense probably benign 0.38
IGL02583:Pde10a APN 17 8981630 missense probably benign 0.23
IGL02649:Pde10a APN 17 8953772 missense probably damaging 1.00
IGL02992:Pde10a APN 17 8949461 missense probably damaging 0.97
IGL03109:Pde10a APN 17 8929214 critical splice donor site probably null
brautigam UTSW 17 8964677 missense possibly damaging 0.78
Bride UTSW 17 8949430 missense possibly damaging 0.60
buzzed UTSW 17 8930537 missense probably damaging 1.00
Gracile UTSW 17 8961920 missense possibly damaging 0.63
Nubile UTSW 17 8967462 missense probably damaging 1.00
thunderball UTSW 17 8969589 missense probably damaging 1.00
R0004:Pde10a UTSW 17 8981576 missense probably benign 0.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0650:Pde10a UTSW 17 8942965 missense probably damaging 1.00
R1173:Pde10a UTSW 17 8920546 splice site probably benign
R1386:Pde10a UTSW 17 8953742 missense probably damaging 1.00
R1458:Pde10a UTSW 17 8964708 missense probably damaging 0.98
R1598:Pde10a UTSW 17 8929144 missense probably damaging 1.00
R1661:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1665:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1883:Pde10a UTSW 17 8978944 missense possibly damaging 0.86
R1960:Pde10a UTSW 17 8942918 missense possibly damaging 0.74
R2005:Pde10a UTSW 17 8929091 critical splice acceptor site probably null
R2071:Pde10a UTSW 17 8961995 missense probably benign 0.22
R2121:Pde10a UTSW 17 8977215 missense probably damaging 1.00
R2376:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R3721:Pde10a UTSW 17 8969589 missense probably damaging 1.00
R3872:Pde10a UTSW 17 8757091 missense possibly damaging 0.92
R4627:Pde10a UTSW 17 8981652 missense probably damaging 1.00
R4652:Pde10a UTSW 17 8757053 missense possibly damaging 0.82
R5107:Pde10a UTSW 17 8944970 missense probably damaging 1.00
R5184:Pde10a UTSW 17 8977155 missense probably damaging 1.00
R5354:Pde10a UTSW 17 8961980 missense probably damaging 0.97
R5735:Pde10a UTSW 17 8941192 missense probably damaging 0.99
R5878:Pde10a UTSW 17 8949372 missense possibly damaging 0.85
R5921:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R6027:Pde10a UTSW 17 8964677 missense possibly damaging 0.78
R6145:Pde10a UTSW 17 8929117 missense probably damaging 1.00
R6279:Pde10a UTSW 17 8978957 missense probably damaging 0.99
R6409:Pde10a UTSW 17 8949438 missense probably damaging 1.00
R6870:Pde10a UTSW 17 8967524 missense possibly damaging 0.56
R6947:Pde10a UTSW 17 8969592 missense probably damaging 1.00
R7072:Pde10a UTSW 17 8943026 missense probably benign 0.40
R7084:Pde10a UTSW 17 8941162 missense probably benign 0.25
R7294:Pde10a UTSW 17 8757021 missense probably benign
R7339:Pde10a UTSW 17 8757028 missense probably benign 0.01
R7347:Pde10a UTSW 17 8967462 missense probably damaging 1.00
R7373:Pde10a UTSW 17 8942992 missense probably benign 0.00
R7481:Pde10a UTSW 17 8949430 missense possibly damaging 0.60
R7833:Pde10a UTSW 17 8961920 missense possibly damaging 0.63
R7923:Pde10a UTSW 17 8929132 missense probably benign 0.40
R8053:Pde10a UTSW 17 8974772 missense probably benign 0.12
R8137:Pde10a UTSW 17 8974815 missense possibly damaging 0.90
R8722:Pde10a UTSW 17 8944940 missense probably benign 0.01
R8918:Pde10a UTSW 17 8941231 missense possibly damaging 0.65
R8973:Pde10a UTSW 17 8924239 missense probably benign
R9113:Pde10a UTSW 17 8978950 missense probably benign
R9275:Pde10a UTSW 17 8981656 makesense probably null
Predicted Primers PCR Primer
(F):5'- ATAGACTCCTGCAGGAACCC -3'
(R):5'- GCACGGTTGTACAAGCTCAG -3'

Sequencing Primer
(F):5'- ACTCAGCCAGGTGTTTGCAG -3'
(R):5'- AGCTCAGTCGGTTTTTATTTAACTG -3'
Posted On 2022-02-07