Incidental Mutation 'R9163:Gldc'
ID 695884
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Name glycine decarboxylase
Synonyms b2b2679Clo, D030049L12Rik, D19Wsu57e
MMRRC Submission 068975-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9163 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 30075847-30152829 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30111686 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 500 (E500V)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
AlphaFold Q91W43
Predicted Effect probably benign
Transcript: ENSMUST00000025778
AA Change: E500V

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: E500V

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,393,400 (GRCm39) S351P possibly damaging Het
4930558K02Rik A G 1: 161,777,174 (GRCm39) S128P probably benign Het
Adam17 C T 12: 21,401,588 (GRCm39) V136I probably benign Het
Adam19 A G 11: 46,018,176 (GRCm39) T413A probably benign Het
Adam28 T C 14: 68,866,531 (GRCm39) K443E probably damaging Het
Adgrv1 T A 13: 81,567,541 (GRCm39) T5211S probably benign Het
Adnp2 A T 18: 80,172,200 (GRCm39) N736K possibly damaging Het
Agtpbp1 C T 13: 59,609,884 (GRCm39) W1082* probably null Het
Ap3b2 T G 7: 81,113,546 (GRCm39) M888L unknown Het
Arhgap35 C A 7: 16,295,549 (GRCm39) R1172L possibly damaging Het
Arrdc3 T A 13: 81,041,506 (GRCm39) D402E probably benign Het
Ccdc14 T C 16: 34,511,118 (GRCm39) F31L possibly damaging Het
Cd5l T G 3: 87,274,932 (GRCm39) L157R probably benign Het
Cdc14a G T 3: 116,122,213 (GRCm39) D251E possibly damaging Het
Cfap210 A T 2: 69,606,510 (GRCm39) I302K probably benign Het
Chmp2a T A 7: 12,766,645 (GRCm39) Q91L possibly damaging Het
Col12a1 A G 9: 79,548,729 (GRCm39) probably null Het
Ctdsp1 G T 1: 74,434,126 (GRCm39) R201L possibly damaging Het
Dhx15 C T 5: 52,342,198 (GRCm39) R40H probably damaging Het
Dnph1 A G 17: 46,809,860 (GRCm39) Y134C probably damaging Het
Foxo1 T A 3: 52,253,301 (GRCm39) V488D probably benign Het
Gcn1 C A 5: 115,742,944 (GRCm39) N1538K probably benign Het
Hhip G A 8: 80,701,743 (GRCm39) T597I probably benign Het
Hmgn1 A G 16: 95,928,509 (GRCm39) probably null Het
Ifi205 A T 1: 173,844,988 (GRCm39) S265T possibly damaging Het
Igkv1-131 T C 6: 67,743,753 (GRCm39) M2V probably benign Het
Irgm2 T G 11: 58,111,280 (GRCm39) S324A probably damaging Het
Jarid2 C G 13: 45,064,727 (GRCm39) D937E possibly damaging Het
Jrkl A T 9: 13,245,404 (GRCm39) W86R probably damaging Het
Kbtbd3 A G 9: 4,330,584 (GRCm39) I319M probably benign Het
Klhl7 T C 5: 24,364,465 (GRCm39) Y500H probably damaging Het
Lats1 C T 10: 7,578,052 (GRCm39) A392V probably benign Het
Llgl1 G T 11: 60,600,402 (GRCm39) A584S probably benign Het
Macf1 G T 4: 123,403,686 (GRCm39) S560Y probably damaging Het
Or4c11 C T 2: 88,695,795 (GRCm39) P282L possibly damaging Het
Or8c10 T A 9: 38,279,378 (GRCm39) C169S probably damaging Het
Pde10a G A 17: 9,181,791 (GRCm39) C498Y possibly damaging Het
Pde4dip A G 3: 97,659,123 (GRCm39) probably null Het
Pdhx G A 2: 102,852,561 (GRCm39) P434L probably damaging Het
Pdlim3 T C 8: 46,338,711 (GRCm39) probably null Het
Pik3c3 T C 18: 30,427,483 (GRCm39) probably null Het
Prkag1 T C 15: 98,711,900 (GRCm39) K242R possibly damaging Het
Rap1b A G 10: 117,654,391 (GRCm39) S150P possibly damaging Het
Scn4a A G 11: 106,217,076 (GRCm39) S1102P probably damaging Het
Scrib A G 15: 75,921,108 (GRCm39) Y1332H probably damaging Het
Sim1 A G 10: 50,772,165 (GRCm39) E58G probably benign Het
Slc13a1 C T 6: 24,097,578 (GRCm39) probably null Het
Slc17a8 A G 10: 89,425,444 (GRCm39) V380A probably damaging Het
Slc5a4b G T 10: 75,917,165 (GRCm39) Y290* probably null Het
Slco4c1 A G 1: 96,764,633 (GRCm39) F480L probably damaging Het
Srcap T C 7: 127,121,162 (GRCm39) V146A unknown Het
Ssc5d T A 7: 4,936,432 (GRCm39) D559E probably damaging Het
Sstr5 A C 17: 25,710,584 (GRCm39) I215S probably damaging Het
Stambpl1 G A 19: 34,212,634 (GRCm39) C268Y probably benign Het
Stard3nl C A 13: 19,560,809 (GRCm39) probably benign Het
Sycp3 T C 10: 88,299,734 (GRCm39) probably null Het
Syne2 A T 12: 76,009,349 (GRCm39) M2417L possibly damaging Het
Tenm4 T G 7: 96,473,080 (GRCm39) Y959D probably damaging Het
Tmem132d T A 5: 127,869,570 (GRCm39) D588V possibly damaging Het
Tnfrsf26 T C 7: 143,172,130 (GRCm39) E60G possibly damaging Het
Topbp1 A G 9: 103,205,767 (GRCm39) R802G probably benign Het
Trmu T C 15: 85,781,096 (GRCm39) V360A probably benign Het
Tshz2 G A 2: 169,726,562 (GRCm39) C386Y probably damaging Het
Ttn A T 2: 76,700,771 (GRCm39) D61E Het
Upf1 T C 8: 70,792,674 (GRCm39) T345A probably benign Het
Vmn2r23 T A 6: 123,718,782 (GRCm39) C712S probably damaging Het
Vmn2r44 C T 7: 8,371,091 (GRCm39) V652I probably benign Het
Wfdc1 T C 8: 120,393,302 (GRCm39) V8A probably benign Het
Xrn1 A G 9: 95,880,274 (GRCm39) Y738C probably benign Het
Zfp618 T G 4: 63,051,511 (GRCm39) V764G probably damaging Het
Znfx1 A T 2: 166,898,261 (GRCm39) M221K probably damaging Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30,092,640 (GRCm39) missense probably damaging 1.00
IGL01016:Gldc APN 19 30,110,893 (GRCm39) missense possibly damaging 0.93
IGL01112:Gldc APN 19 30,135,913 (GRCm39) critical splice donor site probably null
IGL01510:Gldc APN 19 30,091,121 (GRCm39) critical splice donor site probably null
IGL01516:Gldc APN 19 30,076,432 (GRCm39) missense probably damaging 1.00
IGL01598:Gldc APN 19 30,111,156 (GRCm39) missense probably damaging 1.00
IGL01646:Gldc APN 19 30,078,165 (GRCm39) missense possibly damaging 0.61
IGL02024:Gldc APN 19 30,078,227 (GRCm39) missense probably damaging 1.00
IGL02125:Gldc APN 19 30,124,641 (GRCm39) missense probably benign 0.03
IGL02548:Gldc APN 19 30,077,299 (GRCm39) missense probably benign
IGL02711:Gldc APN 19 30,122,546 (GRCm39) critical splice donor site probably null
IGL02818:Gldc APN 19 30,113,909 (GRCm39) missense probably damaging 0.99
IGL02982:Gldc APN 19 30,122,545 (GRCm39) critical splice donor site probably null
IGL03165:Gldc APN 19 30,076,393 (GRCm39) missense possibly damaging 0.61
jojoba UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
miserable UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
Urchin UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
I2289:Gldc UTSW 19 30,124,576 (GRCm39) nonsense probably null
R0180:Gldc UTSW 19 30,078,217 (GRCm39) missense possibly damaging 0.95
R0269:Gldc UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
R0277:Gldc UTSW 19 30,093,851 (GRCm39) missense possibly damaging 0.84
R1085:Gldc UTSW 19 30,128,828 (GRCm39) missense probably damaging 1.00
R1159:Gldc UTSW 19 30,138,162 (GRCm39) intron probably benign
R1500:Gldc UTSW 19 30,091,225 (GRCm39) missense possibly damaging 0.88
R1507:Gldc UTSW 19 30,096,038 (GRCm39) missense probably damaging 1.00
R1592:Gldc UTSW 19 30,138,077 (GRCm39) intron probably benign
R1593:Gldc UTSW 19 30,091,150 (GRCm39) missense probably damaging 1.00
R1675:Gldc UTSW 19 30,120,853 (GRCm39) missense probably damaging 1.00
R1869:Gldc UTSW 19 30,116,732 (GRCm39) missense probably benign
R1965:Gldc UTSW 19 30,114,513 (GRCm39) nonsense probably null
R2312:Gldc UTSW 19 30,078,226 (GRCm39) missense probably damaging 0.98
R2425:Gldc UTSW 19 30,109,190 (GRCm39) missense probably damaging 1.00
R3836:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3837:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3839:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R4191:Gldc UTSW 19 30,123,058 (GRCm39) missense probably damaging 0.96
R4380:Gldc UTSW 19 30,138,168 (GRCm39) intron probably benign
R4508:Gldc UTSW 19 30,120,807 (GRCm39) missense probably damaging 1.00
R4570:Gldc UTSW 19 30,151,839 (GRCm39) missense probably benign
R4655:Gldc UTSW 19 30,138,102 (GRCm39) intron probably benign
R4842:Gldc UTSW 19 30,111,132 (GRCm39) missense possibly damaging 0.94
R5070:Gldc UTSW 19 30,095,998 (GRCm39) missense possibly damaging 0.84
R5085:Gldc UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
R5268:Gldc UTSW 19 30,123,125 (GRCm39) missense probably damaging 0.96
R5368:Gldc UTSW 19 30,135,921 (GRCm39) missense probably benign
R5718:Gldc UTSW 19 30,088,172 (GRCm39) nonsense probably null
R5878:Gldc UTSW 19 30,120,867 (GRCm39) splice site probably null
R6192:Gldc UTSW 19 30,111,172 (GRCm39) missense probably damaging 0.98
R6453:Gldc UTSW 19 30,093,917 (GRCm39) missense probably damaging 0.99
R6777:Gldc UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
R6865:Gldc UTSW 19 30,111,162 (GRCm39) missense possibly damaging 0.92
R7332:Gldc UTSW 19 30,093,926 (GRCm39) missense probably damaging 0.99
R7390:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.46
R7647:Gldc UTSW 19 30,096,067 (GRCm39) missense probably damaging 0.96
R8081:Gldc UTSW 19 30,135,987 (GRCm39) frame shift probably null
R8171:Gldc UTSW 19 30,111,161 (GRCm39) missense probably benign 0.24
R8321:Gldc UTSW 19 30,120,807 (GRCm39) nonsense probably null
R8374:Gldc UTSW 19 30,114,594 (GRCm39) missense probably damaging 1.00
R8503:Gldc UTSW 19 30,077,254 (GRCm39) missense probably benign 0.26
R8510:Gldc UTSW 19 30,093,905 (GRCm39) missense probably damaging 1.00
R8785:Gldc UTSW 19 30,092,634 (GRCm39) missense probably damaging 1.00
R8818:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8820:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8829:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8830:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8859:Gldc UTSW 19 30,116,779 (GRCm39) missense probably damaging 1.00
R8887:Gldc UTSW 19 30,111,156 (GRCm39) missense possibly damaging 0.94
R8935:Gldc UTSW 19 30,109,093 (GRCm39) missense probably benign 0.00
R8940:Gldc UTSW 19 30,128,884 (GRCm39) missense probably benign
R9070:Gldc UTSW 19 30,080,404 (GRCm39) missense probably damaging 1.00
R9100:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.81
R9144:Gldc UTSW 19 30,114,593 (GRCm39) missense
R9429:Gldc UTSW 19 30,091,172 (GRCm39) missense possibly damaging 0.88
Z1177:Gldc UTSW 19 30,123,148 (GRCm39) missense possibly damaging 0.61
Z1177:Gldc UTSW 19 30,088,179 (GRCm39) missense probably damaging 0.99
Z1177:Gldc UTSW 19 30,088,178 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTGGTCAGCATCAGAAAC -3'
(R):5'- GCAACTGATCTGGCTCTGTC -3'

Sequencing Primer
(F):5'- GTGGTCAGCATCAGAAACTGCATC -3'
(R):5'- GATCTGGCTCTGTCTCAGATAATAAC -3'
Posted On 2022-02-07