Incidental Mutation 'R9164:Kif28'
ID 695887
Institutional Source Beutler Lab
Gene Symbol Kif28
Ensembl Gene ENSMUSG00000087236
Gene Name kinesin family member 28
Synonyms LOC383592, Gm1305
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.490) question?
Stock # R9164 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 179695297-179745271 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 179705768 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 604 (M604K)
Ref Sequence ENSEMBL: ENSMUSP00000152770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000131716] [ENSMUST00000211943] [ENSMUST00000221136]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000118935
Gene: ENSMUSG00000087236
AA Change: M604K

DomainStartEndE-ValueType
KISc 3 331 1.02e-120 SMART
low complexity region 343 354 N/A INTRINSIC
FHA 424 473 1.12e-3 SMART
Pfam:KIF1B 615 654 1.3e-7 PFAM
low complexity region 842 857 N/A INTRINSIC
low complexity region 959 973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211943
AA Change: M536K

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably damaging
Transcript: ENSMUST00000221136
AA Change: M604K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,328,157 E3112D probably damaging Het
Abtb2 C T 2: 103,711,484 T847I possibly damaging Het
Acox1 A T 11: 116,198,347 H48Q probably benign Het
Adam9 A G 8: 24,996,779 I161T possibly damaging Het
Ankrd50 A G 3: 38,457,055 Y388H probably damaging Het
Arap1 A T 7: 101,391,883 K593* probably null Het
Bicc1 G A 10: 70,945,264 T661M probably damaging Het
Cela1 A G 15: 100,682,885 probably null Het
Celf1 T A 2: 91,001,081 L85H probably damaging Het
Cep120 A T 18: 53,719,246 M520K probably benign Het
Chd1l C T 3: 97,594,040 R230H probably benign Het
Cyp2c55 A T 19: 39,007,127 K28* probably null Het
D930048N14Rik A T 11: 51,654,782 H167L unknown Het
Ddx58 T A 4: 40,208,827 M762L probably damaging Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Dock4 T A 12: 40,704,338 I442N probably damaging Het
Dpp6 T C 5: 27,451,288 probably null Het
Dysf T C 6: 84,203,326 C1960R probably damaging Het
Gm13941 T C 2: 111,105,979 S2G unknown Het
Gm37240 T C 3: 84,509,941 N157S possibly damaging Het
Gp1ba A G 11: 70,640,457 I350V unknown Het
Gtf3c4 A G 2: 28,834,649 V357A probably benign Het
Hemgn T C 4: 46,396,106 I377V probably benign Het
Hsd3b3 T C 3: 98,753,373 D28G probably benign Het
Intu A T 3: 40,690,703 D508V probably damaging Het
Klra6 T A 6: 130,016,724 I195F possibly damaging Het
Lhfp G A 3: 53,043,466 V54I probably benign Het
Lrpap1 T C 5: 35,105,579 Y38C probably damaging Het
Maats1 A G 16: 38,335,598 Y88H possibly damaging Het
Map1b T A 13: 99,425,843 Q2453L unknown Het
Map1b C A 13: 99,432,308 E1302* probably null Het
Map7 C T 10: 20,246,664 R159C probably benign Het
Mov10l1 C T 15: 89,012,158 T735I probably benign Het
Nfasc C A 1: 132,634,806 R77L probably damaging Het
Nipsnap1 T C 11: 4,889,969 V230A probably benign Het
Olfr1206 C T 2: 88,865,451 P282L possibly damaging Het
Olfr857 T A 9: 19,713,658 M277K probably benign Het
Olfr860 T A 9: 19,846,208 N137I possibly damaging Het
Orm3 T C 4: 63,356,572 L39P probably damaging Het
Pcdhb19 T A 18: 37,498,799 V549E probably damaging Het
Pclo T A 5: 14,681,685 S274R Het
Phactr1 A G 13: 42,682,702 D2G possibly damaging Het
Phtf2 G A 5: 20,803,192 R164* probably null Het
Prkcq A G 2: 11,226,905 D13G probably damaging Het
Proser1 A T 3: 53,472,073 N156I probably benign Het
Prss51 T C 14: 64,097,509 I171T probably damaging Het
Ptbp2 G A 3: 119,752,991 P81S probably damaging Het
Ptk2b T C 14: 66,166,773 D681G possibly damaging Het
Slc7a12 A T 3: 14,499,300 I349F probably damaging Het
Sorcs2 G T 5: 36,077,968 T240K possibly damaging Het
Sowahc C A 10: 59,222,075 A11E probably benign Het
Spag1 A T 15: 36,216,253 Y526F probably damaging Het
Stim1 A G 7: 102,435,419 H526R probably benign Het
Stx1b T C 7: 127,814,987 K69R probably benign Het
Tal1 T C 4: 115,063,449 S107P probably benign Het
Tas2r130 T C 6: 131,630,012 I273M probably damaging Het
Ttc24 A T 3: 88,072,988 Y135* probably null Het
Ttn G A 2: 76,753,512 P22384S probably damaging Het
Vmn2r14 T G 5: 109,216,221 T610P probably damaging Het
Vmn2r84 T A 10: 130,385,800 *850C probably null Het
Vwf T A 6: 125,565,843 I94N Het
Zan A T 5: 137,424,071 S2762T unknown Het
Zbtb20 A G 16: 43,610,401 Q352R probably benign Het
Zfc3h1 T C 10: 115,423,469 Y1649H probably benign Het
Zfp397 A T 18: 23,956,771 Q111L probably damaging Het
Zfp616 T A 11: 74,084,999 I698N probably damaging Het
Other mutations in Kif28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Kif28 APN 1 179702516 missense probably damaging 1.00
IGL00581:Kif28 APN 1 179739957 missense probably benign 0.14
R0348:Kif28 UTSW 1 179731253 missense probably damaging 1.00
R0388:Kif28 UTSW 1 179740089 missense possibly damaging 0.71
R0412:Kif28 UTSW 1 179702526 missense probably benign 0.01
R0788:Kif28 UTSW 1 179705223 unclassified probably benign
R0960:Kif28 UTSW 1 179695805 nonsense probably null
R1365:Kif28 UTSW 1 179739987 nonsense probably null
R1420:Kif28 UTSW 1 179702397 missense probably damaging 1.00
R1442:Kif28 UTSW 1 179705132 missense possibly damaging 0.73
R1507:Kif28 UTSW 1 179736006 missense probably damaging 1.00
R1818:Kif28 UTSW 1 179705754 missense possibly damaging 0.66
R1819:Kif28 UTSW 1 179705754 missense possibly damaging 0.66
R1903:Kif28 UTSW 1 179702523 missense possibly damaging 0.63
R2221:Kif28 UTSW 1 179733111 missense possibly damaging 0.80
R2358:Kif28 UTSW 1 179709459 missense probably damaging 1.00
R4916:Kif28 UTSW 1 179702520 missense probably benign 0.09
R4943:Kif28 UTSW 1 179713951 missense probably benign 0.02
R4967:Kif28 UTSW 1 179708442 missense probably damaging 1.00
R4974:Kif28 UTSW 1 179698644 missense probably damaging 0.98
R5152:Kif28 UTSW 1 179702538 missense probably damaging 1.00
R5382:Kif28 UTSW 1 179700282 missense probably damaging 1.00
R5649:Kif28 UTSW 1 179697771 splice site probably null
R5999:Kif28 UTSW 1 179695790 missense probably damaging 1.00
R6017:Kif28 UTSW 1 179699453 missense probably benign 0.24
R6180:Kif28 UTSW 1 179697772 splice site probably null
R6875:Kif28 UTSW 1 179735994 missense probably damaging 0.98
R7400:Kif28 UTSW 1 179700274 missense probably damaging 1.00
R7402:Kif28 UTSW 1 179740079 missense probably benign 0.00
R7530:Kif28 UTSW 1 179708480 missense probably benign 0.31
R7589:Kif28 UTSW 1 179731400 missense probably benign 0.01
R7648:Kif28 UTSW 1 179709424 missense possibly damaging 0.89
R7815:Kif28 UTSW 1 179735983 missense probably damaging 1.00
R8030:Kif28 UTSW 1 179699064 missense probably benign 0.04
R8050:Kif28 UTSW 1 179709449 missense probably benign 0.00
R8088:Kif28 UTSW 1 179700354 missense probably damaging 1.00
R8781:Kif28 UTSW 1 179697916 missense probably benign 0.00
R8947:Kif28 UTSW 1 179716755 missense possibly damaging 0.94
R9011:Kif28 UTSW 1 179702419 missense possibly damaging 0.89
R9161:Kif28 UTSW 1 179698679 missense probably benign 0.29
R9358:Kif28 UTSW 1 179736130 missense probably benign 0.09
Z1176:Kif28 UTSW 1 179733134 missense probably benign 0.05
Z1177:Kif28 UTSW 1 179728219 missense not run
Predicted Primers PCR Primer
(F):5'- AGTGTGCAGTCATCAGGTGC -3'
(R):5'- TGAATGAACAGCTGAGTGTGTG -3'

Sequencing Primer
(F):5'- TCTGAACTAGGGCAGGCACTC -3'
(R):5'- GTGATTTTATTGACGGCTGAAAAG -3'
Posted On 2022-02-07