Mutagenetix > Incidental Mutation

Incidental Mutation 'R9164:Abtb2'

695893

Institutional Source

Beutler Lab

Gene Symbol

Abtb2

Ensembl Gene

ENSMUSG00000032724

Gene Name

ankyrin repeat and BTB (POZ) domain containing 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9164 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103566310-103718423 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 103711484 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 847 (T847I)

Ref Sequence

ENSEMBL: ENSMUSP00000075566 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076212]

AlphaFold

Q7TQI7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000076212
AA Change: T847I

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724
AA Change: T847I

Domain	Start	End	E-Value	Type
low complexity region	29	48	N/A	INTRINSIC
low complexity region	122	143	N/A	INTRINSIC
Blast:H2A	186	301	2e-38	BLAST
low complexity region	366	376	N/A	INTRINSIC
ANK	521	550	4.78e-7	SMART
ANK	567	596	6.26e-2	SMART
ANK	606	635	3.65e-3	SMART
ANK	649	678	5.52e2	SMART
ANK	715	746	1.84e3	SMART
BTB	844	946	9.15e-24	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

97% (63/65)

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	C	11: 9,328,157	E3112D	probably damaging	Het
Acox1	A	T	11: 116,198,347	H48Q	probably benign	Het
Adam9	A	G	8: 24,996,779	I161T	possibly damaging	Het
Ankrd50	A	G	3: 38,457,055	Y388H	probably damaging	Het
Arap1	A	T	7: 101,391,883	K593*	probably null	Het
Bicc1	G	A	10: 70,945,264	T661M	probably damaging	Het
Cela1	A	G	15: 100,682,885		probably null	Het
Celf1	T	A	2: 91,001,081	L85H	probably damaging	Het
Cep120	A	T	18: 53,719,246	M520K	probably benign	Het
Chd1l	C	T	3: 97,594,040	R230H	probably benign	Het
Cyp2c55	A	T	19: 39,007,127	K28*	probably null	Het
D930048N14Rik	A	T	11: 51,654,782	H167L	unknown	Het
Ddx58	T	A	4: 40,208,827	M762L	probably damaging	Het
Dnah11	C	T	12: 118,027,516	E2372K	probably damaging	Het
Dock4	T	A	12: 40,704,338	I442N	probably damaging	Het
Dpp6	T	C	5: 27,451,288		probably null	Het
Dysf	T	C	6: 84,203,326	C1960R	probably damaging	Het
Gm13941	T	C	2: 111,105,979	S2G	unknown	Het
Gm37240	T	C	3: 84,509,941	N157S	possibly damaging	Het
Gp1ba	A	G	11: 70,640,457	I350V	unknown	Het
Gtf3c4	A	G	2: 28,834,649	V357A	probably benign	Het
Hemgn	T	C	4: 46,396,106	I377V	probably benign	Het
Hsd3b3	T	C	3: 98,753,373	D28G	probably benign	Het
Intu	A	T	3: 40,690,703	D508V	probably damaging	Het
Kif28	A	T	1: 179,705,768	M604K	probably damaging	Het
Klra6	T	A	6: 130,016,724	I195F	possibly damaging	Het
Lhfp	G	A	3: 53,043,466	V54I	probably benign	Het
Lrpap1	T	C	5: 35,105,579	Y38C	probably damaging	Het
Maats1	A	G	16: 38,335,598	Y88H	possibly damaging	Het
Map1b	T	A	13: 99,425,843	Q2453L	unknown	Het
Map1b	C	A	13: 99,432,308	E1302*	probably null	Het
Map7	C	T	10: 20,246,664	R159C	probably benign	Het
Mov10l1	C	T	15: 89,012,158	T735I	probably benign	Het
Nfasc	C	A	1: 132,634,806	R77L	probably damaging	Het
Nipsnap1	T	C	11: 4,889,969	V230A	probably benign	Het
Olfr1206	C	T	2: 88,865,451	P282L	possibly damaging	Het
Olfr857	T	A	9: 19,713,658	M277K	probably benign	Het
Olfr860	T	A	9: 19,846,208	N137I	possibly damaging	Het
Orm3	T	C	4: 63,356,572	L39P	probably damaging	Het
Pcdhb19	T	A	18: 37,498,799	V549E	probably damaging	Het
Pclo	T	A	5: 14,681,685	S274R		Het
Phactr1	A	G	13: 42,682,702	D2G	possibly damaging	Het
Phtf2	G	A	5: 20,803,192	R164*	probably null	Het
Prkcq	A	G	2: 11,226,905	D13G	probably damaging	Het
Proser1	A	T	3: 53,472,073	N156I	probably benign	Het
Prss51	T	C	14: 64,097,509	I171T	probably damaging	Het
Ptbp2	G	A	3: 119,752,991	P81S	probably damaging	Het
Ptk2b	T	C	14: 66,166,773	D681G	possibly damaging	Het
Slc7a12	A	T	3: 14,499,300	I349F	probably damaging	Het
Sorcs2	G	T	5: 36,077,968	T240K	possibly damaging	Het
Sowahc	C	A	10: 59,222,075	A11E	probably benign	Het
Spag1	A	T	15: 36,216,253	Y526F	probably damaging	Het
Stim1	A	G	7: 102,435,419	H526R	probably benign	Het
Stx1b	T	C	7: 127,814,987	K69R	probably benign	Het
Tal1	T	C	4: 115,063,449	S107P	probably benign	Het
Tas2r130	T	C	6: 131,630,012	I273M	probably damaging	Het
Ttc24	A	T	3: 88,072,988	Y135*	probably null	Het
Ttn	G	A	2: 76,753,512	P22384S	probably damaging	Het
Vmn2r14	T	G	5: 109,216,221	T610P	probably damaging	Het
Vmn2r84	T	A	10: 130,385,800	*850C	probably null	Het
Vwf	T	A	6: 125,565,843	I94N		Het
Zan	A	T	5: 137,424,071	S2762T	unknown	Het
Zbtb20	A	G	16: 43,610,401	Q352R	probably benign	Het
Zfc3h1	T	C	10: 115,423,469	Y1649H	probably benign	Het
Zfp397	A	T	18: 23,956,771	Q111L	probably damaging	Het
Zfp616	T	A	11: 74,084,999	I698N	probably damaging	Het

Other mutations in Abtb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01161:Abtb2	APN	2	103705118	missense	probably benign	0.00
IGL02605:Abtb2	APN	2	103717257	missense	probably benign
IGL03161:Abtb2	APN	2	103567454	missense	probably benign	0.02
PIT4504001:Abtb2	UTSW	2	103717192	nonsense	probably null
R0147:Abtb2	UTSW	2	103567135	missense	probably benign	0.04
R1052:Abtb2	UTSW	2	103705072	missense	possibly damaging	0.46
R1419:Abtb2	UTSW	2	103709420	missense	probably benign	0.00
R1518:Abtb2	UTSW	2	103709284	missense	probably benign	0.03
R1650:Abtb2	UTSW	2	103702402	missense	probably damaging	1.00
R1795:Abtb2	UTSW	2	103567024	missense	probably benign	0.00
R2054:Abtb2	UTSW	2	103705117	missense	probably benign	0.41
R2101:Abtb2	UTSW	2	103566862	missense	probably benign	0.05
R2363:Abtb2	UTSW	2	103567183	missense	probably damaging	1.00
R3440:Abtb2	UTSW	2	103567232	missense	probably benign	0.43
R3927:Abtb2	UTSW	2	103708218	splice site	probably null
R4351:Abtb2	UTSW	2	103683393	missense	possibly damaging	0.46
R4352:Abtb2	UTSW	2	103683393	missense	possibly damaging	0.46
R4782:Abtb2	UTSW	2	103717299	missense	probably benign	0.35
R4814:Abtb2	UTSW	2	103717287	missense	probably benign	0.08
R4831:Abtb2	UTSW	2	103683475	missense	probably benign	0.06
R4900:Abtb2	UTSW	2	103567004	missense	possibly damaging	0.62
R5038:Abtb2	UTSW	2	103567063	missense	probably damaging	0.99
R5513:Abtb2	UTSW	2	103709278	critical splice acceptor site	probably null
R6119:Abtb2	UTSW	2	103702310	missense	probably benign	0.00
R6298:Abtb2	UTSW	2	103709488	missense	probably benign	0.10
R6383:Abtb2	UTSW	2	103567376	missense	probably damaging	0.98
R6860:Abtb2	UTSW	2	103709425	nonsense	probably null
R7000:Abtb2	UTSW	2	103712442	missense	possibly damaging	0.85
R7109:Abtb2	UTSW	2	103715515	missense	probably benign	0.20
R7176:Abtb2	UTSW	2	103709375	missense	probably benign	0.00
R7189:Abtb2	UTSW	2	103567516	missense	probably benign	0.00
R7199:Abtb2	UTSW	2	103567220	missense	possibly damaging	0.74
R7299:Abtb2	UTSW	2	103702424	splice site	probably null
R7347:Abtb2	UTSW	2	103567412	missense	probably damaging	1.00
R7469:Abtb2	UTSW	2	103566947	missense	probably benign	0.00
R7629:Abtb2	UTSW	2	103683493	critical splice donor site	probably null
R7862:Abtb2	UTSW	2	103702281	missense	probably damaging	1.00
R8200:Abtb2	UTSW	2	103700817	missense	probably benign	0.02
R8682:Abtb2	UTSW	2	103567375	missense	probably benign	0.36
R8700:Abtb2	UTSW	2	103566944	missense	probably damaging	0.99
R9196:Abtb2	UTSW	2	103683302	missense	possibly damaging	0.71
R9254:Abtb2	UTSW	2	103711235	missense	probably benign	0.00
R9258:Abtb2	UTSW	2	103716065	missense	probably null	0.99
R9343:Abtb2	UTSW	2	103717160	missense	probably benign
R9427:Abtb2	UTSW	2	103700899	missense	probably damaging	1.00
R9675:Abtb2	UTSW	2	103708187	missense	probably benign
Z1176:Abtb2	UTSW	2	103708172	nonsense	probably null
Z1177:Abtb2	UTSW	2	103711196	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGTATCCATGCCCGCTAG -3'
(R):5'- TATCCATGCTGGGATTGCCTC -3'

Sequencing Primer
(F):5'- CGCTAGGGCTTGTTCCC -3'
(R):5'- TCCTAAGCTAGACCTAGGTGGAATC -3'

Posted On

2022-02-07