Incidental Mutation 'R9164:Abtb2'
ID 695893
Institutional Source Beutler Lab
Gene Symbol Abtb2
Ensembl Gene ENSMUSG00000032724
Gene Name ankyrin repeat and BTB domain containing 2
Synonyms BPOZ-2
MMRRC Submission 068944-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9164 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 103396655-103548768 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 103541829 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 847 (T847I)
Ref Sequence ENSEMBL: ENSMUSP00000075566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076212]
AlphaFold Q7TQI7
Predicted Effect possibly damaging
Transcript: ENSMUST00000076212
AA Change: T847I

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724
AA Change: T847I

DomainStartEndE-ValueType
low complexity region 29 48 N/A INTRINSIC
low complexity region 122 143 N/A INTRINSIC
Blast:H2A 186 301 2e-38 BLAST
low complexity region 366 376 N/A INTRINSIC
ANK 521 550 4.78e-7 SMART
ANK 567 596 6.26e-2 SMART
ANK 606 635 3.65e-3 SMART
ANK 649 678 5.52e2 SMART
ANK 715 746 1.84e3 SMART
BTB 844 946 9.15e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,278,157 (GRCm39) E3112D probably damaging Het
Acox1 A T 11: 116,089,173 (GRCm39) H48Q probably benign Het
Adam9 A G 8: 25,486,795 (GRCm39) I161T possibly damaging Het
Ankrd50 A G 3: 38,511,204 (GRCm39) Y388H probably damaging Het
Arap1 A T 7: 101,041,090 (GRCm39) K593* probably null Het
Bicc1 G A 10: 70,781,094 (GRCm39) T661M probably damaging Het
Cela1 A G 15: 100,580,766 (GRCm39) probably null Het
Celf1 T A 2: 90,831,426 (GRCm39) L85H probably damaging Het
Cep120 A T 18: 53,852,318 (GRCm39) M520K probably benign Het
Cfap91 A G 16: 38,155,960 (GRCm39) Y88H possibly damaging Het
Chd1l C T 3: 97,501,356 (GRCm39) R230H probably benign Het
Cyp2c55 A T 19: 38,995,571 (GRCm39) K28* probably null Het
D930048N14Rik A T 11: 51,545,609 (GRCm39) H167L unknown Het
Dnah11 C T 12: 117,991,251 (GRCm39) E2372K probably damaging Het
Dock4 T A 12: 40,754,337 (GRCm39) I442N probably damaging Het
Dpp6 T C 5: 27,656,286 (GRCm39) probably null Het
Dysf T C 6: 84,180,308 (GRCm39) C1960R probably damaging Het
Gm13941 T C 2: 110,936,324 (GRCm39) S2G unknown Het
Gm37240 T C 3: 84,417,248 (GRCm39) N157S possibly damaging Het
Gp1ba A G 11: 70,531,283 (GRCm39) I350V unknown Het
Gtf3c4 A G 2: 28,724,661 (GRCm39) V357A probably benign Het
Hemgn T C 4: 46,396,106 (GRCm39) I377V probably benign Het
Hsd3b3 T C 3: 98,660,689 (GRCm39) D28G probably benign Het
Intu A T 3: 40,645,133 (GRCm39) D508V probably damaging Het
Kif28 A T 1: 179,533,333 (GRCm39) M604K probably damaging Het
Klra6 T A 6: 129,993,687 (GRCm39) I195F possibly damaging Het
Lhfpl6 G A 3: 52,950,887 (GRCm39) V54I probably benign Het
Lrpap1 T C 5: 35,262,923 (GRCm39) Y38C probably damaging Het
Map1b T A 13: 99,562,351 (GRCm39) Q2453L unknown Het
Map1b C A 13: 99,568,816 (GRCm39) E1302* probably null Het
Map7 C T 10: 20,122,410 (GRCm39) R159C probably benign Het
Mov10l1 C T 15: 88,896,361 (GRCm39) T735I probably benign Het
Nfasc C A 1: 132,562,544 (GRCm39) R77L probably damaging Het
Nipsnap1 T C 11: 4,839,969 (GRCm39) V230A probably benign Het
Or4c11 C T 2: 88,695,795 (GRCm39) P282L possibly damaging Het
Or7e166 T A 9: 19,624,954 (GRCm39) M277K probably benign Het
Or7e169 T A 9: 19,757,504 (GRCm39) N137I possibly damaging Het
Orm3 T C 4: 63,274,809 (GRCm39) L39P probably damaging Het
Pcdhb19 T A 18: 37,631,852 (GRCm39) V549E probably damaging Het
Pclo T A 5: 14,731,699 (GRCm39) S274R Het
Phactr1 A G 13: 42,836,178 (GRCm39) D2G possibly damaging Het
Phtf2 G A 5: 21,008,190 (GRCm39) R164* probably null Het
Prkcq A G 2: 11,231,716 (GRCm39) D13G probably damaging Het
Proser1 A T 3: 53,379,494 (GRCm39) N156I probably benign Het
Prss51 T C 14: 64,334,958 (GRCm39) I171T probably damaging Het
Ptbp2 G A 3: 119,546,640 (GRCm39) P81S probably damaging Het
Ptk2b T C 14: 66,404,222 (GRCm39) D681G possibly damaging Het
Rigi T A 4: 40,208,827 (GRCm39) M762L probably damaging Het
Slc7a12 A T 3: 14,564,360 (GRCm39) I349F probably damaging Het
Sorcs2 G T 5: 36,235,312 (GRCm39) T240K possibly damaging Het
Sowahc C A 10: 59,057,897 (GRCm39) A11E probably benign Het
Spag1 A T 15: 36,216,399 (GRCm39) Y526F probably damaging Het
Stim1 A G 7: 102,084,626 (GRCm39) H526R probably benign Het
Stx1b T C 7: 127,414,159 (GRCm39) K69R probably benign Het
Tal1 T C 4: 114,920,646 (GRCm39) S107P probably benign Het
Tas2r130 T C 6: 131,606,975 (GRCm39) I273M probably damaging Het
Ttc24 A T 3: 87,980,295 (GRCm39) Y135* probably null Het
Ttn G A 2: 76,583,856 (GRCm39) P22384S probably damaging Het
Vmn2r14 T G 5: 109,364,087 (GRCm39) T610P probably damaging Het
Vmn2r84 T A 10: 130,221,669 (GRCm39) *850C probably null Het
Vwf T A 6: 125,542,806 (GRCm39) I94N Het
Zan A T 5: 137,422,333 (GRCm39) S2762T unknown Het
Zbtb20 A G 16: 43,430,764 (GRCm39) Q352R probably benign Het
Zfc3h1 T C 10: 115,259,374 (GRCm39) Y1649H probably benign Het
Zfp397 A T 18: 24,089,828 (GRCm39) Q111L probably damaging Het
Zfp616 T A 11: 73,975,825 (GRCm39) I698N probably damaging Het
Other mutations in Abtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Abtb2 APN 2 103,535,463 (GRCm39) missense probably benign 0.00
IGL02605:Abtb2 APN 2 103,547,602 (GRCm39) missense probably benign
IGL03161:Abtb2 APN 2 103,397,799 (GRCm39) missense probably benign 0.02
PIT4504001:Abtb2 UTSW 2 103,547,537 (GRCm39) nonsense probably null
R0147:Abtb2 UTSW 2 103,397,480 (GRCm39) missense probably benign 0.04
R1052:Abtb2 UTSW 2 103,535,417 (GRCm39) missense possibly damaging 0.46
R1419:Abtb2 UTSW 2 103,539,765 (GRCm39) missense probably benign 0.00
R1518:Abtb2 UTSW 2 103,539,629 (GRCm39) missense probably benign 0.03
R1650:Abtb2 UTSW 2 103,532,747 (GRCm39) missense probably damaging 1.00
R1795:Abtb2 UTSW 2 103,397,369 (GRCm39) missense probably benign 0.00
R2054:Abtb2 UTSW 2 103,535,462 (GRCm39) missense probably benign 0.41
R2101:Abtb2 UTSW 2 103,397,207 (GRCm39) missense probably benign 0.05
R2363:Abtb2 UTSW 2 103,397,528 (GRCm39) missense probably damaging 1.00
R3440:Abtb2 UTSW 2 103,397,577 (GRCm39) missense probably benign 0.43
R3927:Abtb2 UTSW 2 103,538,563 (GRCm39) splice site probably null
R4351:Abtb2 UTSW 2 103,513,738 (GRCm39) missense possibly damaging 0.46
R4352:Abtb2 UTSW 2 103,513,738 (GRCm39) missense possibly damaging 0.46
R4782:Abtb2 UTSW 2 103,547,644 (GRCm39) missense probably benign 0.35
R4814:Abtb2 UTSW 2 103,547,632 (GRCm39) missense probably benign 0.08
R4831:Abtb2 UTSW 2 103,513,820 (GRCm39) missense probably benign 0.06
R4900:Abtb2 UTSW 2 103,397,349 (GRCm39) missense possibly damaging 0.62
R5038:Abtb2 UTSW 2 103,397,408 (GRCm39) missense probably damaging 0.99
R5513:Abtb2 UTSW 2 103,539,623 (GRCm39) critical splice acceptor site probably null
R6119:Abtb2 UTSW 2 103,532,655 (GRCm39) missense probably benign 0.00
R6298:Abtb2 UTSW 2 103,539,833 (GRCm39) missense probably benign 0.10
R6383:Abtb2 UTSW 2 103,397,721 (GRCm39) missense probably damaging 0.98
R6860:Abtb2 UTSW 2 103,539,770 (GRCm39) nonsense probably null
R7000:Abtb2 UTSW 2 103,542,787 (GRCm39) missense possibly damaging 0.85
R7109:Abtb2 UTSW 2 103,545,860 (GRCm39) missense probably benign 0.20
R7176:Abtb2 UTSW 2 103,539,720 (GRCm39) missense probably benign 0.00
R7189:Abtb2 UTSW 2 103,397,861 (GRCm39) missense probably benign 0.00
R7199:Abtb2 UTSW 2 103,397,565 (GRCm39) missense possibly damaging 0.74
R7299:Abtb2 UTSW 2 103,532,769 (GRCm39) splice site probably null
R7347:Abtb2 UTSW 2 103,397,757 (GRCm39) missense probably damaging 1.00
R7469:Abtb2 UTSW 2 103,397,292 (GRCm39) missense probably benign 0.00
R7629:Abtb2 UTSW 2 103,513,838 (GRCm39) critical splice donor site probably null
R7862:Abtb2 UTSW 2 103,532,626 (GRCm39) missense probably damaging 1.00
R8200:Abtb2 UTSW 2 103,531,162 (GRCm39) missense probably benign 0.02
R8682:Abtb2 UTSW 2 103,397,720 (GRCm39) missense probably benign 0.36
R8700:Abtb2 UTSW 2 103,397,289 (GRCm39) missense probably damaging 0.99
R9196:Abtb2 UTSW 2 103,513,647 (GRCm39) missense possibly damaging 0.71
R9254:Abtb2 UTSW 2 103,541,580 (GRCm39) missense probably benign 0.00
R9258:Abtb2 UTSW 2 103,546,410 (GRCm39) missense probably null 0.99
R9343:Abtb2 UTSW 2 103,547,505 (GRCm39) missense probably benign
R9427:Abtb2 UTSW 2 103,531,244 (GRCm39) missense probably damaging 1.00
R9675:Abtb2 UTSW 2 103,538,532 (GRCm39) missense probably benign
Z1176:Abtb2 UTSW 2 103,538,517 (GRCm39) nonsense probably null
Z1177:Abtb2 UTSW 2 103,541,541 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTATCCATGCCCGCTAG -3'
(R):5'- TATCCATGCTGGGATTGCCTC -3'

Sequencing Primer
(F):5'- CGCTAGGGCTTGTTCCC -3'
(R):5'- TCCTAAGCTAGACCTAGGTGGAATC -3'
Posted On 2022-02-07