Incidental Mutation 'R9164:Ttc24'
ID 695901
Institutional Source Beutler Lab
Gene Symbol Ttc24
Ensembl Gene ENSMUSG00000051036
Gene Name tetratricopeptide repeat domain 24
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R9164 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 88069410-88078304 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 88072988 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 135 (Y135*)
Ref Sequence ENSEMBL: ENSMUSP00000061571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050258] [ENSMUST00000064550]
AlphaFold Q8BYG0
Predicted Effect probably null
Transcript: ENSMUST00000050258
AA Change: Y135*
SMART Domains Protein: ENSMUSP00000061571
Gene: ENSMUSG00000051036
AA Change: Y135*

DomainStartEndE-ValueType
TPR 35 68 3.5e0 SMART
TPR 72 105 4.09e-1 SMART
TPR 112 145 3.41e1 SMART
TPR 152 185 6.95e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064550
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,328,157 E3112D probably damaging Het
Abtb2 C T 2: 103,711,484 T847I possibly damaging Het
Acox1 A T 11: 116,198,347 H48Q probably benign Het
Adam9 A G 8: 24,996,779 I161T possibly damaging Het
Ankrd50 A G 3: 38,457,055 Y388H probably damaging Het
Arap1 A T 7: 101,391,883 K593* probably null Het
Bicc1 G A 10: 70,945,264 T661M probably damaging Het
Cela1 A G 15: 100,682,885 probably null Het
Celf1 T A 2: 91,001,081 L85H probably damaging Het
Cep120 A T 18: 53,719,246 M520K probably benign Het
Chd1l C T 3: 97,594,040 R230H probably benign Het
Cyp2c55 A T 19: 39,007,127 K28* probably null Het
D930048N14Rik A T 11: 51,654,782 H167L unknown Het
Ddx58 T A 4: 40,208,827 M762L probably damaging Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Dock4 T A 12: 40,704,338 I442N probably damaging Het
Dpp6 T C 5: 27,451,288 probably null Het
Dysf T C 6: 84,203,326 C1960R probably damaging Het
Gm13941 T C 2: 111,105,979 S2G unknown Het
Gm37240 T C 3: 84,509,941 N157S possibly damaging Het
Gp1ba A G 11: 70,640,457 I350V unknown Het
Gtf3c4 A G 2: 28,834,649 V357A probably benign Het
Hemgn T C 4: 46,396,106 I377V probably benign Het
Hsd3b3 T C 3: 98,753,373 D28G probably benign Het
Intu A T 3: 40,690,703 D508V probably damaging Het
Kif28 A T 1: 179,705,768 M604K probably damaging Het
Klra6 T A 6: 130,016,724 I195F possibly damaging Het
Lhfp G A 3: 53,043,466 V54I probably benign Het
Lrpap1 T C 5: 35,105,579 Y38C probably damaging Het
Maats1 A G 16: 38,335,598 Y88H possibly damaging Het
Map1b T A 13: 99,425,843 Q2453L unknown Het
Map1b C A 13: 99,432,308 E1302* probably null Het
Map7 C T 10: 20,246,664 R159C probably benign Het
Mov10l1 C T 15: 89,012,158 T735I probably benign Het
Nfasc C A 1: 132,634,806 R77L probably damaging Het
Nipsnap1 T C 11: 4,889,969 V230A probably benign Het
Olfr1206 C T 2: 88,865,451 P282L possibly damaging Het
Olfr857 T A 9: 19,713,658 M277K probably benign Het
Olfr860 T A 9: 19,846,208 N137I possibly damaging Het
Orm3 T C 4: 63,356,572 L39P probably damaging Het
Pcdhb19 T A 18: 37,498,799 V549E probably damaging Het
Pclo T A 5: 14,681,685 S274R Het
Phactr1 A G 13: 42,682,702 D2G possibly damaging Het
Phtf2 G A 5: 20,803,192 R164* probably null Het
Prkcq A G 2: 11,226,905 D13G probably damaging Het
Proser1 A T 3: 53,472,073 N156I probably benign Het
Prss51 T C 14: 64,097,509 I171T probably damaging Het
Ptbp2 G A 3: 119,752,991 P81S probably damaging Het
Ptk2b T C 14: 66,166,773 D681G possibly damaging Het
Slc7a12 A T 3: 14,499,300 I349F probably damaging Het
Sorcs2 G T 5: 36,077,968 T240K possibly damaging Het
Sowahc C A 10: 59,222,075 A11E probably benign Het
Spag1 A T 15: 36,216,253 Y526F probably damaging Het
Stim1 A G 7: 102,435,419 H526R probably benign Het
Stx1b T C 7: 127,814,987 K69R probably benign Het
Tal1 T C 4: 115,063,449 S107P probably benign Het
Tas2r130 T C 6: 131,630,012 I273M probably damaging Het
Ttn G A 2: 76,753,512 P22384S probably damaging Het
Vmn2r14 T G 5: 109,216,221 T610P probably damaging Het
Vmn2r84 T A 10: 130,385,800 *850C probably null Het
Vwf T A 6: 125,565,843 I94N Het
Zan A T 5: 137,424,071 S2762T unknown Het
Zbtb20 A G 16: 43,610,401 Q352R probably benign Het
Zfc3h1 T C 10: 115,423,469 Y1649H probably benign Het
Zfp397 A T 18: 23,956,771 Q111L probably damaging Het
Zfp616 T A 11: 74,084,999 I698N probably damaging Het
Other mutations in Ttc24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01896:Ttc24 APN 3 88070413 critical splice acceptor site probably null
IGL03069:Ttc24 APN 3 88070101 missense probably benign 0.07
R0153:Ttc24 UTSW 3 88074927 unclassified probably benign
R1626:Ttc24 UTSW 3 88070059 missense probably benign 0.00
R1735:Ttc24 UTSW 3 88073094 splice site probably null
R1938:Ttc24 UTSW 3 88074874 missense probably benign 0.28
R4112:Ttc24 UTSW 3 88074639 missense probably damaging 0.99
R4200:Ttc24 UTSW 3 88074517 missense probably benign 0.01
R7600:Ttc24 UTSW 3 88072013 start codon destroyed probably null
R7939:Ttc24 UTSW 3 88074638 missense possibly damaging 0.83
R8432:Ttc24 UTSW 3 88070059 missense probably benign 0.15
R8519:Ttc24 UTSW 3 88073062 missense probably damaging 1.00
R8784:Ttc24 UTSW 3 88072726 nonsense probably null
R9370:Ttc24 UTSW 3 88072829 missense probably benign 0.20
R9531:Ttc24 UTSW 3 88071109 missense possibly damaging 0.79
Z1176:Ttc24 UTSW 3 88071058 frame shift probably null
Z1176:Ttc24 UTSW 3 88071986 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGTCATGTTGTCCCAGTCTG -3'
(R):5'- AACTTTGGGACTCCTGGGATC -3'

Sequencing Primer
(F):5'- TTGTCCCAGTCTGGCTGCAG -3'
(R):5'- CCTACTCAGACTGACCTGTT -3'
Posted On 2022-02-07