Incidental Mutation 'R9164:Hsd3b3'
ID 695903
Institutional Source Beutler Lab
Gene Symbol Hsd3b3
Ensembl Gene ENSMUSG00000062410
Gene Name hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock # R9164 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 98741523-98763127 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98753373 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 28 (D28G)
Ref Sequence ENSEMBL: ENSMUSP00000088246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090743] [ENSMUST00000094050] [ENSMUST00000107018] [ENSMUST00000107019] [ENSMUST00000146196]
AlphaFold P26150
Predicted Effect probably benign
Transcript: ENSMUST00000090743
AA Change: D28G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000088246
Gene: ENSMUSG00000062410
AA Change: D28G

DomainStartEndE-ValueType
Pfam:KR 5 132 8.2e-7 PFAM
Pfam:adh_short 5 133 3.9e-8 PFAM
Pfam:Polysacc_synt_2 6 134 3.5e-13 PFAM
Pfam:NmrA 6 136 2.5e-8 PFAM
Pfam:NAD_binding_10 6 237 5.8e-10 PFAM
Pfam:Epimerase 6 256 1.4e-27 PFAM
Pfam:3Beta_HSD 7 288 1.6e-114 PFAM
Pfam:NAD_binding_4 8 220 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094050
AA Change: D28G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000091592
Gene: ENSMUSG00000062410
AA Change: D28G

DomainStartEndE-ValueType
Pfam:3Beta_HSD 7 51 2e-12 PFAM
Pfam:NAD_binding_4 39 162 7.4e-7 PFAM
Pfam:Epimerase 43 201 2.1e-12 PFAM
Pfam:3Beta_HSD 48 233 4.1e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107018
AA Change: D28G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102632
Gene: ENSMUSG00000062410
AA Change: D28G

DomainStartEndE-ValueType
Pfam:KR 5 132 8.2e-7 PFAM
Pfam:adh_short 5 133 3.9e-8 PFAM
Pfam:Polysacc_synt_2 6 134 3.5e-13 PFAM
Pfam:NmrA 6 136 2.5e-8 PFAM
Pfam:NAD_binding_10 6 237 5.8e-10 PFAM
Pfam:Epimerase 6 256 1.4e-27 PFAM
Pfam:3Beta_HSD 7 288 1.6e-114 PFAM
Pfam:NAD_binding_4 8 220 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107019
AA Change: D28G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000102633
Gene: ENSMUSG00000062410
AA Change: D28G

DomainStartEndE-ValueType
Pfam:Polysacc_synt_2 6 135 1.9e-13 PFAM
Pfam:NmrA 6 137 5.6e-8 PFAM
Pfam:Epimerase 6 250 2e-26 PFAM
Pfam:GDP_Man_Dehyd 7 213 1.9e-13 PFAM
Pfam:3Beta_HSD 7 288 4.3e-116 PFAM
Pfam:NAD_binding_4 8 207 2.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146196
AA Change: D28G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000121360
Gene: ENSMUSG00000062410
AA Change: D28G

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 4 174 1.9e-7 PFAM
Pfam:adh_short 5 133 5.6e-9 PFAM
Pfam:KR 5 133 9.5e-8 PFAM
Pfam:Polysacc_synt_2 6 135 2.8e-14 PFAM
Pfam:NmrA 6 137 1.8e-9 PFAM
Pfam:Epimerase 6 187 2.2e-23 PFAM
Pfam:NAD_binding_10 6 187 1.4e-10 PFAM
Pfam:3Beta_HSD 7 187 9.3e-76 PFAM
Pfam:NAD_binding_4 8 176 6.5e-20 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,328,157 E3112D probably damaging Het
Abtb2 C T 2: 103,711,484 T847I possibly damaging Het
Acox1 A T 11: 116,198,347 H48Q probably benign Het
Adam9 A G 8: 24,996,779 I161T possibly damaging Het
Ankrd50 A G 3: 38,457,055 Y388H probably damaging Het
Arap1 A T 7: 101,391,883 K593* probably null Het
Bicc1 G A 10: 70,945,264 T661M probably damaging Het
Cela1 A G 15: 100,682,885 probably null Het
Celf1 T A 2: 91,001,081 L85H probably damaging Het
Cep120 A T 18: 53,719,246 M520K probably benign Het
Chd1l C T 3: 97,594,040 R230H probably benign Het
Cyp2c55 A T 19: 39,007,127 K28* probably null Het
D930048N14Rik A T 11: 51,654,782 H167L unknown Het
Ddx58 T A 4: 40,208,827 M762L probably damaging Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Dock4 T A 12: 40,704,338 I442N probably damaging Het
Dpp6 T C 5: 27,451,288 probably null Het
Dysf T C 6: 84,203,326 C1960R probably damaging Het
Gm13941 T C 2: 111,105,979 S2G unknown Het
Gm37240 T C 3: 84,509,941 N157S possibly damaging Het
Gp1ba A G 11: 70,640,457 I350V unknown Het
Gtf3c4 A G 2: 28,834,649 V357A probably benign Het
Hemgn T C 4: 46,396,106 I377V probably benign Het
Intu A T 3: 40,690,703 D508V probably damaging Het
Kif28 A T 1: 179,705,768 M604K probably damaging Het
Klra6 T A 6: 130,016,724 I195F possibly damaging Het
Lhfp G A 3: 53,043,466 V54I probably benign Het
Lrpap1 T C 5: 35,105,579 Y38C probably damaging Het
Maats1 A G 16: 38,335,598 Y88H possibly damaging Het
Map1b T A 13: 99,425,843 Q2453L unknown Het
Map1b C A 13: 99,432,308 E1302* probably null Het
Map7 C T 10: 20,246,664 R159C probably benign Het
Mov10l1 C T 15: 89,012,158 T735I probably benign Het
Nfasc C A 1: 132,634,806 R77L probably damaging Het
Nipsnap1 T C 11: 4,889,969 V230A probably benign Het
Olfr1206 C T 2: 88,865,451 P282L possibly damaging Het
Olfr857 T A 9: 19,713,658 M277K probably benign Het
Olfr860 T A 9: 19,846,208 N137I possibly damaging Het
Orm3 T C 4: 63,356,572 L39P probably damaging Het
Pcdhb19 T A 18: 37,498,799 V549E probably damaging Het
Pclo T A 5: 14,681,685 S274R Het
Phactr1 A G 13: 42,682,702 D2G possibly damaging Het
Phtf2 G A 5: 20,803,192 R164* probably null Het
Prkcq A G 2: 11,226,905 D13G probably damaging Het
Proser1 A T 3: 53,472,073 N156I probably benign Het
Prss51 T C 14: 64,097,509 I171T probably damaging Het
Ptbp2 G A 3: 119,752,991 P81S probably damaging Het
Ptk2b T C 14: 66,166,773 D681G possibly damaging Het
Slc7a12 A T 3: 14,499,300 I349F probably damaging Het
Sorcs2 G T 5: 36,077,968 T240K possibly damaging Het
Sowahc C A 10: 59,222,075 A11E probably benign Het
Spag1 A T 15: 36,216,253 Y526F probably damaging Het
Stim1 A G 7: 102,435,419 H526R probably benign Het
Stx1b T C 7: 127,814,987 K69R probably benign Het
Tal1 T C 4: 115,063,449 S107P probably benign Het
Tas2r130 T C 6: 131,630,012 I273M probably damaging Het
Ttc24 A T 3: 88,072,988 Y135* probably null Het
Ttn G A 2: 76,753,512 P22384S probably damaging Het
Vmn2r14 T G 5: 109,216,221 T610P probably damaging Het
Vmn2r84 T A 10: 130,385,800 *850C probably null Het
Vwf T A 6: 125,565,843 I94N Het
Zan A T 5: 137,424,071 S2762T unknown Het
Zbtb20 A G 16: 43,610,401 Q352R probably benign Het
Zfc3h1 T C 10: 115,423,469 Y1649H probably benign Het
Zfp397 A T 18: 23,956,771 Q111L probably damaging Het
Zfp616 T A 11: 74,084,999 I698N probably damaging Het
Other mutations in Hsd3b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01551:Hsd3b3 APN 3 98741900 missense probably benign 0.09
IGL01776:Hsd3b3 APN 3 98743847 missense probably benign 0.05
IGL02189:Hsd3b3 APN 3 98742138 missense probably benign
R0689:Hsd3b3 UTSW 3 98741979 missense possibly damaging 0.76
R0893:Hsd3b3 UTSW 3 98742441 splice site probably null
R1759:Hsd3b3 UTSW 3 98742083 missense probably damaging 0.96
R2008:Hsd3b3 UTSW 3 98742092 missense probably damaging 1.00
R3931:Hsd3b3 UTSW 3 98742176 missense probably damaging 1.00
R4614:Hsd3b3 UTSW 3 98742080 missense probably benign 0.03
R4664:Hsd3b3 UTSW 3 98742216 missense probably damaging 1.00
R4749:Hsd3b3 UTSW 3 98742615 missense probably damaging 1.00
R4766:Hsd3b3 UTSW 3 98742485 missense probably damaging 1.00
R4876:Hsd3b3 UTSW 3 98742644 missense probably damaging 1.00
R5074:Hsd3b3 UTSW 3 98742024 missense possibly damaging 0.94
R5622:Hsd3b3 UTSW 3 98742208 missense possibly damaging 0.79
R6280:Hsd3b3 UTSW 3 98753305 splice site probably null
R6348:Hsd3b3 UTSW 3 98755949 splice site probably null
R7070:Hsd3b3 UTSW 3 98742471 missense possibly damaging 0.64
R7283:Hsd3b3 UTSW 3 98742357 nonsense probably null
R7747:Hsd3b3 UTSW 3 98743898 missense possibly damaging 0.76
R8054:Hsd3b3 UTSW 3 98742015 missense probably damaging 1.00
R8553:Hsd3b3 UTSW 3 98743889 missense possibly damaging 0.87
R9130:Hsd3b3 UTSW 3 98743895 missense possibly damaging 0.94
R9333:Hsd3b3 UTSW 3 98741900 missense probably benign 0.09
Z1176:Hsd3b3 UTSW 3 98743960 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCCAAACTGTGTTTTGCTATGTG -3'
(R):5'- TGGGGAAATCACCAGATCTCTC -3'

Sequencing Primer
(F):5'- CCTTTTGATGAATGTGGACATGGAG -3'
(R):5'- GGAAATCACCAGATCTCTCTTTCTAG -3'
Posted On 2022-02-07