Incidental Mutation 'R9164:Klra6'
ID 695918
Institutional Source Beutler Lab
Gene Symbol Klra6
Ensembl Gene ENSMUSG00000061769
Gene Name killer cell lectin-like receptor, subfamily A, member 6
Synonyms Ly49F, Ly49f
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.046) question?
Stock # R9164 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 130013033-130026954 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 130016724 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 195 (I195F)
Ref Sequence ENSEMBL: ENSMUSP00000073700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074056]
AlphaFold Q60653
Predicted Effect possibly damaging
Transcript: ENSMUST00000074056
AA Change: I195F

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073700
Gene: ENSMUSG00000061769
AA Change: I195F

DomainStartEndE-ValueType
Blast:CLECT 73 123 3e-9 BLAST
CLECT 143 258 8.42e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: This gene belongs to the highly polymorphic family of C-type lectin-like Ly49 genes that are expressed in natural killer (NK) cells. The encoded protein is a homodimeric type II transmembrane receptor located at the cell surface and inhibits NK cell activation upon ligand binding. This gene is located in a cluster of several Klra paralogs on chromosome 6. Different strains of mice show variation in the number of paralogs, including strain specific duplications, deletions and pseudogene sequences. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,328,157 E3112D probably damaging Het
Abtb2 C T 2: 103,711,484 T847I possibly damaging Het
Acox1 A T 11: 116,198,347 H48Q probably benign Het
Adam9 A G 8: 24,996,779 I161T possibly damaging Het
Ankrd50 A G 3: 38,457,055 Y388H probably damaging Het
Arap1 A T 7: 101,391,883 K593* probably null Het
Bicc1 G A 10: 70,945,264 T661M probably damaging Het
Cela1 A G 15: 100,682,885 probably null Het
Celf1 T A 2: 91,001,081 L85H probably damaging Het
Cep120 A T 18: 53,719,246 M520K probably benign Het
Chd1l C T 3: 97,594,040 R230H probably benign Het
Cyp2c55 A T 19: 39,007,127 K28* probably null Het
D930048N14Rik A T 11: 51,654,782 H167L unknown Het
Ddx58 T A 4: 40,208,827 M762L probably damaging Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Dock4 T A 12: 40,704,338 I442N probably damaging Het
Dpp6 T C 5: 27,451,288 probably null Het
Dysf T C 6: 84,203,326 C1960R probably damaging Het
Gm13941 T C 2: 111,105,979 S2G unknown Het
Gm37240 T C 3: 84,509,941 N157S possibly damaging Het
Gp1ba A G 11: 70,640,457 I350V unknown Het
Gtf3c4 A G 2: 28,834,649 V357A probably benign Het
Hemgn T C 4: 46,396,106 I377V probably benign Het
Hsd3b3 T C 3: 98,753,373 D28G probably benign Het
Intu A T 3: 40,690,703 D508V probably damaging Het
Kif28 A T 1: 179,705,768 M604K probably damaging Het
Lhfp G A 3: 53,043,466 V54I probably benign Het
Lrpap1 T C 5: 35,105,579 Y38C probably damaging Het
Maats1 A G 16: 38,335,598 Y88H possibly damaging Het
Map1b T A 13: 99,425,843 Q2453L unknown Het
Map1b C A 13: 99,432,308 E1302* probably null Het
Map7 C T 10: 20,246,664 R159C probably benign Het
Mov10l1 C T 15: 89,012,158 T735I probably benign Het
Nfasc C A 1: 132,634,806 R77L probably damaging Het
Nipsnap1 T C 11: 4,889,969 V230A probably benign Het
Olfr1206 C T 2: 88,865,451 P282L possibly damaging Het
Olfr857 T A 9: 19,713,658 M277K probably benign Het
Olfr860 T A 9: 19,846,208 N137I possibly damaging Het
Orm3 T C 4: 63,356,572 L39P probably damaging Het
Pcdhb19 T A 18: 37,498,799 V549E probably damaging Het
Pclo T A 5: 14,681,685 S274R Het
Phactr1 A G 13: 42,682,702 D2G possibly damaging Het
Phtf2 G A 5: 20,803,192 R164* probably null Het
Prkcq A G 2: 11,226,905 D13G probably damaging Het
Proser1 A T 3: 53,472,073 N156I probably benign Het
Prss51 T C 14: 64,097,509 I171T probably damaging Het
Ptbp2 G A 3: 119,752,991 P81S probably damaging Het
Ptk2b T C 14: 66,166,773 D681G possibly damaging Het
Slc7a12 A T 3: 14,499,300 I349F probably damaging Het
Sorcs2 G T 5: 36,077,968 T240K possibly damaging Het
Sowahc C A 10: 59,222,075 A11E probably benign Het
Spag1 A T 15: 36,216,253 Y526F probably damaging Het
Stim1 A G 7: 102,435,419 H526R probably benign Het
Stx1b T C 7: 127,814,987 K69R probably benign Het
Tal1 T C 4: 115,063,449 S107P probably benign Het
Tas2r130 T C 6: 131,630,012 I273M probably damaging Het
Ttc24 A T 3: 88,072,988 Y135* probably null Het
Ttn G A 2: 76,753,512 P22384S probably damaging Het
Vmn2r14 T G 5: 109,216,221 T610P probably damaging Het
Vmn2r84 T A 10: 130,385,800 *850C probably null Het
Vwf T A 6: 125,565,843 I94N Het
Zan A T 5: 137,424,071 S2762T unknown Het
Zbtb20 A G 16: 43,610,401 Q352R probably benign Het
Zfc3h1 T C 10: 115,423,469 Y1649H probably benign Het
Zfp397 A T 18: 23,956,771 Q111L probably damaging Het
Zfp616 T A 11: 74,084,999 I698N probably damaging Het
Other mutations in Klra6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Klra6 APN 6 130023700 missense possibly damaging 0.77
IGL02037:Klra6 APN 6 130013476 missense probably benign 0.02
IGL02319:Klra6 APN 6 130025214 missense probably damaging 0.98
IGL02427:Klra6 APN 6 130016717 missense possibly damaging 0.54
IGL02730:Klra6 APN 6 130022697 missense probably benign
IGL02822:Klra6 APN 6 130016710 nonsense probably null
R0485:Klra6 UTSW 6 130023638 missense probably benign 0.12
R0697:Klra6 UTSW 6 130016724 missense probably benign 0.18
R0731:Klra6 UTSW 6 130022705 missense probably damaging 1.00
R1081:Klra6 UTSW 6 130022625 missense probably damaging 0.96
R1708:Klra6 UTSW 6 130022714 nonsense probably null
R1749:Klra6 UTSW 6 130018952 missense probably damaging 1.00
R1842:Klra6 UTSW 6 130022610 missense probably benign 0.14
R1944:Klra6 UTSW 6 130018945 missense possibly damaging 0.92
R4214:Klra6 UTSW 6 130018922 missense probably benign 0.10
R5210:Klra6 UTSW 6 130018892 nonsense probably null
R5286:Klra6 UTSW 6 130018969 missense probably benign 0.02
R5418:Klra6 UTSW 6 130013430 missense probably damaging 0.96
R5764:Klra6 UTSW 6 130022729 missense possibly damaging 0.92
R6193:Klra6 UTSW 6 130018918 missense probably benign 0.12
R6536:Klra6 UTSW 6 130023719 missense probably benign 0.07
R6696:Klra6 UTSW 6 130016733 missense probably benign
R7021:Klra6 UTSW 6 130018858 missense possibly damaging 0.93
R7718:Klra6 UTSW 6 130013352 frame shift probably null
R8500:Klra6 UTSW 6 130022697 missense probably benign
R8910:Klra6 UTSW 6 130016684 missense probably benign
R8983:Klra6 UTSW 6 130022610 missense probably benign 0.14
R9775:Klra6 UTSW 6 130022676 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCCTGAGCTCCATAGAAAATGAG -3'
(R):5'- CCGTGAACTGAGGACTCTTG -3'

Sequencing Primer
(F):5'- CTCCATAGAAAATGAGGAAAACCATG -3'
(R):5'- GGAATACTGGGAACTTTTCCT -3'
Posted On 2022-02-07