Incidental Mutation 'R9164:Tas2r130'
ID 695919
Institutional Source Beutler Lab
Gene Symbol Tas2r130
Ensembl Gene ENSMUSG00000054497
Gene Name taste receptor, type 2, member 130
Synonyms T2R30, mt2r42, STC 7-4, Tas2r30
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock # R9164 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 131629823-131630912 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 131630012 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 273 (I273M)
Ref Sequence ENSEMBL: ENSMUSP00000063954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067597]
AlphaFold P59530
Predicted Effect probably damaging
Transcript: ENSMUST00000067597
AA Change: I273M

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000063954
Gene: ENSMUSG00000054497
AA Change: I273M

DomainStartEndE-ValueType
Pfam:TAS2R 1 304 1.7e-110 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,328,157 E3112D probably damaging Het
Abtb2 C T 2: 103,711,484 T847I possibly damaging Het
Acox1 A T 11: 116,198,347 H48Q probably benign Het
Adam9 A G 8: 24,996,779 I161T possibly damaging Het
Ankrd50 A G 3: 38,457,055 Y388H probably damaging Het
Arap1 A T 7: 101,391,883 K593* probably null Het
Bicc1 G A 10: 70,945,264 T661M probably damaging Het
Cela1 A G 15: 100,682,885 probably null Het
Celf1 T A 2: 91,001,081 L85H probably damaging Het
Cep120 A T 18: 53,719,246 M520K probably benign Het
Chd1l C T 3: 97,594,040 R230H probably benign Het
Cyp2c55 A T 19: 39,007,127 K28* probably null Het
D930048N14Rik A T 11: 51,654,782 H167L unknown Het
Ddx58 T A 4: 40,208,827 M762L probably damaging Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Dock4 T A 12: 40,704,338 I442N probably damaging Het
Dpp6 T C 5: 27,451,288 probably null Het
Dysf T C 6: 84,203,326 C1960R probably damaging Het
Gm13941 T C 2: 111,105,979 S2G unknown Het
Gm37240 T C 3: 84,509,941 N157S possibly damaging Het
Gp1ba A G 11: 70,640,457 I350V unknown Het
Gtf3c4 A G 2: 28,834,649 V357A probably benign Het
Hemgn T C 4: 46,396,106 I377V probably benign Het
Hsd3b3 T C 3: 98,753,373 D28G probably benign Het
Intu A T 3: 40,690,703 D508V probably damaging Het
Kif28 A T 1: 179,705,768 M604K probably damaging Het
Klra6 T A 6: 130,016,724 I195F possibly damaging Het
Lhfp G A 3: 53,043,466 V54I probably benign Het
Lrpap1 T C 5: 35,105,579 Y38C probably damaging Het
Maats1 A G 16: 38,335,598 Y88H possibly damaging Het
Map1b T A 13: 99,425,843 Q2453L unknown Het
Map1b C A 13: 99,432,308 E1302* probably null Het
Map7 C T 10: 20,246,664 R159C probably benign Het
Mov10l1 C T 15: 89,012,158 T735I probably benign Het
Nfasc C A 1: 132,634,806 R77L probably damaging Het
Nipsnap1 T C 11: 4,889,969 V230A probably benign Het
Olfr1206 C T 2: 88,865,451 P282L possibly damaging Het
Olfr857 T A 9: 19,713,658 M277K probably benign Het
Olfr860 T A 9: 19,846,208 N137I possibly damaging Het
Orm3 T C 4: 63,356,572 L39P probably damaging Het
Pcdhb19 T A 18: 37,498,799 V549E probably damaging Het
Pclo T A 5: 14,681,685 S274R Het
Phactr1 A G 13: 42,682,702 D2G possibly damaging Het
Phtf2 G A 5: 20,803,192 R164* probably null Het
Prkcq A G 2: 11,226,905 D13G probably damaging Het
Proser1 A T 3: 53,472,073 N156I probably benign Het
Prss51 T C 14: 64,097,509 I171T probably damaging Het
Ptbp2 G A 3: 119,752,991 P81S probably damaging Het
Ptk2b T C 14: 66,166,773 D681G possibly damaging Het
Slc7a12 A T 3: 14,499,300 I349F probably damaging Het
Sorcs2 G T 5: 36,077,968 T240K possibly damaging Het
Sowahc C A 10: 59,222,075 A11E probably benign Het
Spag1 A T 15: 36,216,253 Y526F probably damaging Het
Stim1 A G 7: 102,435,419 H526R probably benign Het
Stx1b T C 7: 127,814,987 K69R probably benign Het
Tal1 T C 4: 115,063,449 S107P probably benign Het
Ttc24 A T 3: 88,072,988 Y135* probably null Het
Ttn G A 2: 76,753,512 P22384S probably damaging Het
Vmn2r14 T G 5: 109,216,221 T610P probably damaging Het
Vmn2r84 T A 10: 130,385,800 *850C probably null Het
Vwf T A 6: 125,565,843 I94N Het
Zan A T 5: 137,424,071 S2762T unknown Het
Zbtb20 A G 16: 43,610,401 Q352R probably benign Het
Zfc3h1 T C 10: 115,423,469 Y1649H probably benign Het
Zfp397 A T 18: 23,956,771 Q111L probably damaging Het
Zfp616 T A 11: 74,084,999 I698N probably damaging Het
Other mutations in Tas2r130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Tas2r130 APN 6 131630271 missense probably damaging 1.00
IGL01412:Tas2r130 APN 6 131630510 nonsense probably null
IGL01554:Tas2r130 APN 6 131630083 missense probably benign 0.44
IGL01789:Tas2r130 APN 6 131630155 missense probably damaging 1.00
R1552:Tas2r130 UTSW 6 131630167 missense probably benign 0.00
R1848:Tas2r130 UTSW 6 131630597 missense probably benign 0.00
R2020:Tas2r130 UTSW 6 131630769 missense probably damaging 1.00
R2060:Tas2r130 UTSW 6 131630817 missense probably benign 0.00
R2518:Tas2r130 UTSW 6 131630073 missense probably damaging 0.98
R3810:Tas2r130 UTSW 6 131630829 start codon destroyed probably null 1.00
R5666:Tas2r130 UTSW 6 131630379 missense possibly damaging 0.82
R6225:Tas2r130 UTSW 6 131630584 small deletion probably benign
R7180:Tas2r130 UTSW 6 131630248 missense probably benign 0.00
R7284:Tas2r130 UTSW 6 131630307 missense probably benign 0.02
R7385:Tas2r130 UTSW 6 131630263 missense probably benign
R8424:Tas2r130 UTSW 6 131630827 missense probably benign 0.00
R8845:Tas2r130 UTSW 6 131630679 missense probably benign 0.03
R9409:Tas2r130 UTSW 6 131630697 missense probably damaging 1.00
R9561:Tas2r130 UTSW 6 131630212 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTTAAGAGGATGTCACTGCATG -3'
(R):5'- CCAGGCAGATACAACTCAGTG -3'

Sequencing Primer
(F):5'- AAGGACGGATAATGATCGTGTCTTCC -3'
(R):5'- TACAACTCAGTGTAACAGGGTAC -3'
Posted On 2022-02-07