Incidental Mutation 'R9164:Stx1b'
ID 695922
Institutional Source Beutler Lab
Gene Symbol Stx1b
Ensembl Gene ENSMUSG00000030806
Gene Name syntaxin 1B
Synonyms Stx1b2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock # R9164 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 127803900-127824549 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 127814987 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 69 (K69R)
Ref Sequence ENSEMBL: ENSMUSP00000101874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106267] [ENSMUST00000156135]
AlphaFold P61264
Predicted Effect probably benign
Transcript: ENSMUST00000106267
AA Change: K69R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101874
Gene: ENSMUSG00000030806
AA Change: K69R

DomainStartEndE-ValueType
SynN 24 145 1.99e-44 SMART
t_SNARE 186 253 4.32e-24 SMART
transmembrane domain 265 287 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156135
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of proteins thought to play a role in the exocytosis of synaptic vesicles. Vesicle exocytosis releases vesicular contents and is important to various cellular functions. For instance, the secretion of transmitters from neurons plays an important role in synaptic transmission. After exocytosis, the membrane and proteins from the vesicle are retrieved from the plasma membrane through the process of endocytosis. Mutations in this gene have been identified as one cause of fever-associated epilepsy syndromes. A possible link between this gene and Parkinson's disease has also been suggested. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a reporter allele that encodes an 'open' syntaxin-1B protein conformation are viable but display severe ataxia, reduced chromaffin vesicle docking, accelerated synaptic vesicle fusion, and lethal epileptic seizures after 2 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,328,157 E3112D probably damaging Het
Abtb2 C T 2: 103,711,484 T847I possibly damaging Het
Acox1 A T 11: 116,198,347 H48Q probably benign Het
Adam9 A G 8: 24,996,779 I161T possibly damaging Het
Ankrd50 A G 3: 38,457,055 Y388H probably damaging Het
Arap1 A T 7: 101,391,883 K593* probably null Het
Bicc1 G A 10: 70,945,264 T661M probably damaging Het
Cela1 A G 15: 100,682,885 probably null Het
Celf1 T A 2: 91,001,081 L85H probably damaging Het
Cep120 A T 18: 53,719,246 M520K probably benign Het
Chd1l C T 3: 97,594,040 R230H probably benign Het
Cyp2c55 A T 19: 39,007,127 K28* probably null Het
D930048N14Rik A T 11: 51,654,782 H167L unknown Het
Ddx58 T A 4: 40,208,827 M762L probably damaging Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Dock4 T A 12: 40,704,338 I442N probably damaging Het
Dpp6 T C 5: 27,451,288 probably null Het
Dysf T C 6: 84,203,326 C1960R probably damaging Het
Gm13941 T C 2: 111,105,979 S2G unknown Het
Gm37240 T C 3: 84,509,941 N157S possibly damaging Het
Gp1ba A G 11: 70,640,457 I350V unknown Het
Gtf3c4 A G 2: 28,834,649 V357A probably benign Het
Hemgn T C 4: 46,396,106 I377V probably benign Het
Hsd3b3 T C 3: 98,753,373 D28G probably benign Het
Intu A T 3: 40,690,703 D508V probably damaging Het
Kif28 A T 1: 179,705,768 M604K probably damaging Het
Klra6 T A 6: 130,016,724 I195F possibly damaging Het
Lhfp G A 3: 53,043,466 V54I probably benign Het
Lrpap1 T C 5: 35,105,579 Y38C probably damaging Het
Maats1 A G 16: 38,335,598 Y88H possibly damaging Het
Map1b T A 13: 99,425,843 Q2453L unknown Het
Map1b C A 13: 99,432,308 E1302* probably null Het
Map7 C T 10: 20,246,664 R159C probably benign Het
Mov10l1 C T 15: 89,012,158 T735I probably benign Het
Nfasc C A 1: 132,634,806 R77L probably damaging Het
Nipsnap1 T C 11: 4,889,969 V230A probably benign Het
Olfr1206 C T 2: 88,865,451 P282L possibly damaging Het
Olfr857 T A 9: 19,713,658 M277K probably benign Het
Olfr860 T A 9: 19,846,208 N137I possibly damaging Het
Orm3 T C 4: 63,356,572 L39P probably damaging Het
Pcdhb19 T A 18: 37,498,799 V549E probably damaging Het
Pclo T A 5: 14,681,685 S274R Het
Phactr1 A G 13: 42,682,702 D2G possibly damaging Het
Phtf2 G A 5: 20,803,192 R164* probably null Het
Prkcq A G 2: 11,226,905 D13G probably damaging Het
Proser1 A T 3: 53,472,073 N156I probably benign Het
Prss51 T C 14: 64,097,509 I171T probably damaging Het
Ptbp2 G A 3: 119,752,991 P81S probably damaging Het
Ptk2b T C 14: 66,166,773 D681G possibly damaging Het
Slc7a12 A T 3: 14,499,300 I349F probably damaging Het
Sorcs2 G T 5: 36,077,968 T240K possibly damaging Het
Sowahc C A 10: 59,222,075 A11E probably benign Het
Spag1 A T 15: 36,216,253 Y526F probably damaging Het
Stim1 A G 7: 102,435,419 H526R probably benign Het
Tal1 T C 4: 115,063,449 S107P probably benign Het
Tas2r130 T C 6: 131,630,012 I273M probably damaging Het
Ttc24 A T 3: 88,072,988 Y135* probably null Het
Ttn G A 2: 76,753,512 P22384S probably damaging Het
Vmn2r14 T G 5: 109,216,221 T610P probably damaging Het
Vmn2r84 T A 10: 130,385,800 *850C probably null Het
Vwf T A 6: 125,565,843 I94N Het
Zan A T 5: 137,424,071 S2762T unknown Het
Zbtb20 A G 16: 43,610,401 Q352R probably benign Het
Zfc3h1 T C 10: 115,423,469 Y1649H probably benign Het
Zfp397 A T 18: 23,956,771 Q111L probably damaging Het
Zfp616 T A 11: 74,084,999 I698N probably damaging Het
Other mutations in Stx1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Stx1b APN 7 127810698 missense probably damaging 1.00
IGL02730:Stx1b APN 7 127815377 missense probably benign 0.37
IGL03394:Stx1b APN 7 127807884 missense probably damaging 1.00
R0680:Stx1b UTSW 7 127807723 missense possibly damaging 0.80
R1141:Stx1b UTSW 7 127810926 splice site probably null
R1511:Stx1b UTSW 7 127814972 missense probably damaging 0.99
R2024:Stx1b UTSW 7 127815403 missense probably benign 0.00
R2116:Stx1b UTSW 7 127810905 missense probably damaging 1.00
R4964:Stx1b UTSW 7 127807921 missense probably damaging 1.00
R4966:Stx1b UTSW 7 127807921 missense probably damaging 1.00
R5385:Stx1b UTSW 7 127815403 missense probably benign 0.00
R5386:Stx1b UTSW 7 127815403 missense probably benign 0.00
R5777:Stx1b UTSW 7 127810918 nonsense probably null
R6092:Stx1b UTSW 7 127807863 missense possibly damaging 0.94
R6184:Stx1b UTSW 7 127807905 missense possibly damaging 0.79
R6688:Stx1b UTSW 7 127807896 missense probably damaging 1.00
R6843:Stx1b UTSW 7 127814979 nonsense probably null
R7493:Stx1b UTSW 7 127807359 missense possibly damaging 0.88
R7919:Stx1b UTSW 7 127807335 missense probably benign 0.19
R8401:Stx1b UTSW 7 127807773 splice site probably benign
R9608:Stx1b UTSW 7 127807379 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTTTCCAAAGGACGTGGGC -3'
(R):5'- GGTGTCACTGATTTCCTGCC -3'

Sequencing Primer
(F):5'- GCAAAAGTGGGCTTGTACATTTCTC -3'
(R):5'- TGCCCCAGGTGGAAGAGATC -3'
Posted On 2022-02-07