Incidental Mutation 'R9164:Gp1ba'
ID 695934
Institutional Source Beutler Lab
Gene Symbol Gp1ba
Ensembl Gene ENSMUSG00000050675
Gene Name glycoprotein 1b, alpha polypeptide
Synonyms GP Ib-alpha, GPIb-alpha, GPIba
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock # R9164 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 70639122-70642036 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70640457 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 350 (I350V)
Ref Sequence ENSEMBL: ENSMUSP00000104191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014750] [ENSMUST00000055184] [ENSMUST00000108551] [ENSMUST00000139638]
AlphaFold O35930
Predicted Effect probably benign
Transcript: ENSMUST00000014750
SMART Domains Protein: ENSMUSP00000014750
Gene: ENSMUSG00000014606

DomainStartEndE-ValueType
Pfam:Mito_carr 18 112 1.3e-22 PFAM
Pfam:Mito_carr 115 213 2.6e-19 PFAM
Pfam:Mito_carr 216 311 5.2e-21 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000055184
AA Change: I350V
SMART Domains Protein: ENSMUSP00000057563
Gene: ENSMUSG00000050675
AA Change: I350V

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
LRRNT 19 51 1.66e-1 SMART
LRR 70 91 2.54e2 SMART
LRR 92 114 9.96e-1 SMART
LRR_TYP 115 138 1.56e-2 SMART
LRR_TYP 139 162 1.47e-3 SMART
LRR 163 186 1.89e-1 SMART
LRR 187 210 8.09e-1 SMART
LRRCT 221 281 2.53e-12 SMART
low complexity region 403 432 N/A INTRINSIC
low complexity region 446 530 N/A INTRINSIC
low complexity region 533 579 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
PDB:2BP3|T 680 701 2e-6 PDB
Predicted Effect unknown
Transcript: ENSMUST00000108551
AA Change: I350V
SMART Domains Protein: ENSMUSP00000104191
Gene: ENSMUSG00000050675
AA Change: I350V

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
LRRNT 19 51 1.66e-1 SMART
LRR 70 91 2.54e2 SMART
LRR 92 114 9.96e-1 SMART
LRR_TYP 115 138 1.56e-2 SMART
LRR_TYP 139 162 1.47e-3 SMART
LRR 163 186 1.89e-1 SMART
LRR 187 210 8.09e-1 SMART
LRRCT 221 281 2.53e-12 SMART
low complexity region 403 432 N/A INTRINSIC
low complexity region 446 530 N/A INTRINSIC
low complexity region 533 579 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
PDB:2BP3|T 680 701 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000139638
SMART Domains Protein: ENSMUSP00000114685
Gene: ENSMUSG00000014606

DomainStartEndE-ValueType
Pfam:Mito_carr 1 80 7.4e-17 PFAM
Pfam:Mito_carr 83 181 1.1e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that is linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. This gene encodes the alpha subunit. Mutations in this gene result in Bernard-Soulier syndromes and platelet-type von Willebrand disease. The coding region of this gene is known to contain a polymophic variable number tandem repeat (VNTR) domain that is associated with susceptibility to nonarteritic anterior ischemic optic neuropathy. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit prolonged bleeding times and reduced numbers of enlarged platelets. Heterozygotes have intermediate numbers of platelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,328,157 E3112D probably damaging Het
Abtb2 C T 2: 103,711,484 T847I possibly damaging Het
Acox1 A T 11: 116,198,347 H48Q probably benign Het
Adam9 A G 8: 24,996,779 I161T possibly damaging Het
Ankrd50 A G 3: 38,457,055 Y388H probably damaging Het
Arap1 A T 7: 101,391,883 K593* probably null Het
Bicc1 G A 10: 70,945,264 T661M probably damaging Het
Cela1 A G 15: 100,682,885 probably null Het
Celf1 T A 2: 91,001,081 L85H probably damaging Het
Cep120 A T 18: 53,719,246 M520K probably benign Het
Chd1l C T 3: 97,594,040 R230H probably benign Het
Cyp2c55 A T 19: 39,007,127 K28* probably null Het
D930048N14Rik A T 11: 51,654,782 H167L unknown Het
Ddx58 T A 4: 40,208,827 M762L probably damaging Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Dock4 T A 12: 40,704,338 I442N probably damaging Het
Dpp6 T C 5: 27,451,288 probably null Het
Dysf T C 6: 84,203,326 C1960R probably damaging Het
Gm13941 T C 2: 111,105,979 S2G unknown Het
Gm37240 T C 3: 84,509,941 N157S possibly damaging Het
Gtf3c4 A G 2: 28,834,649 V357A probably benign Het
Hemgn T C 4: 46,396,106 I377V probably benign Het
Hsd3b3 T C 3: 98,753,373 D28G probably benign Het
Intu A T 3: 40,690,703 D508V probably damaging Het
Kif28 A T 1: 179,705,768 M604K probably damaging Het
Klra6 T A 6: 130,016,724 I195F possibly damaging Het
Lhfp G A 3: 53,043,466 V54I probably benign Het
Lrpap1 T C 5: 35,105,579 Y38C probably damaging Het
Maats1 A G 16: 38,335,598 Y88H possibly damaging Het
Map1b T A 13: 99,425,843 Q2453L unknown Het
Map1b C A 13: 99,432,308 E1302* probably null Het
Map7 C T 10: 20,246,664 R159C probably benign Het
Mov10l1 C T 15: 89,012,158 T735I probably benign Het
Nfasc C A 1: 132,634,806 R77L probably damaging Het
Nipsnap1 T C 11: 4,889,969 V230A probably benign Het
Olfr1206 C T 2: 88,865,451 P282L possibly damaging Het
Olfr857 T A 9: 19,713,658 M277K probably benign Het
Olfr860 T A 9: 19,846,208 N137I possibly damaging Het
Orm3 T C 4: 63,356,572 L39P probably damaging Het
Pcdhb19 T A 18: 37,498,799 V549E probably damaging Het
Pclo T A 5: 14,681,685 S274R Het
Phactr1 A G 13: 42,682,702 D2G possibly damaging Het
Phtf2 G A 5: 20,803,192 R164* probably null Het
Prkcq A G 2: 11,226,905 D13G probably damaging Het
Proser1 A T 3: 53,472,073 N156I probably benign Het
Prss51 T C 14: 64,097,509 I171T probably damaging Het
Ptbp2 G A 3: 119,752,991 P81S probably damaging Het
Ptk2b T C 14: 66,166,773 D681G possibly damaging Het
Slc7a12 A T 3: 14,499,300 I349F probably damaging Het
Sorcs2 G T 5: 36,077,968 T240K possibly damaging Het
Sowahc C A 10: 59,222,075 A11E probably benign Het
Spag1 A T 15: 36,216,253 Y526F probably damaging Het
Stim1 A G 7: 102,435,419 H526R probably benign Het
Stx1b T C 7: 127,814,987 K69R probably benign Het
Tal1 T C 4: 115,063,449 S107P probably benign Het
Tas2r130 T C 6: 131,630,012 I273M probably damaging Het
Ttc24 A T 3: 88,072,988 Y135* probably null Het
Ttn G A 2: 76,753,512 P22384S probably damaging Het
Vmn2r14 T G 5: 109,216,221 T610P probably damaging Het
Vmn2r84 T A 10: 130,385,800 *850C probably null Het
Vwf T A 6: 125,565,843 I94N Het
Zan A T 5: 137,424,071 S2762T unknown Het
Zbtb20 A G 16: 43,610,401 Q352R probably benign Het
Zfc3h1 T C 10: 115,423,469 Y1649H probably benign Het
Zfp397 A T 18: 23,956,771 Q111L probably damaging Het
Zfp616 T A 11: 74,084,999 I698N probably damaging Het
Other mutations in Gp1ba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Gp1ba APN 11 70640652 unclassified probably benign
IGL00715:Gp1ba APN 11 70639918 unclassified probably benign
R0126:Gp1ba UTSW 11 70641033 unclassified probably benign
R0329:Gp1ba UTSW 11 70640409 unclassified probably benign
R0360:Gp1ba UTSW 11 70640458 unclassified probably benign
R0364:Gp1ba UTSW 11 70640458 unclassified probably benign
R0561:Gp1ba UTSW 11 70639590 unclassified probably benign
R0693:Gp1ba UTSW 11 70640458 unclassified probably benign
R0715:Gp1ba UTSW 11 70640788 unclassified probably benign
R0762:Gp1ba UTSW 11 70641427 missense probably damaging 1.00
R0766:Gp1ba UTSW 11 70641427 missense probably damaging 1.00
R1178:Gp1ba UTSW 11 70641427 missense probably damaging 1.00
R1181:Gp1ba UTSW 11 70641427 missense probably damaging 1.00
R1448:Gp1ba UTSW 11 70641427 missense probably damaging 1.00
R1926:Gp1ba UTSW 11 70640889 unclassified probably benign
R2317:Gp1ba UTSW 11 70640647 unclassified probably benign
R5101:Gp1ba UTSW 11 70641399 missense probably benign 0.13
R6243:Gp1ba UTSW 11 70640137 unclassified probably benign
R7020:Gp1ba UTSW 11 70640313 unclassified probably benign
R7340:Gp1ba UTSW 11 70640293 missense unknown
R7571:Gp1ba UTSW 11 70640094 missense unknown
R8224:Gp1ba UTSW 11 70639857 missense unknown
R8958:Gp1ba UTSW 11 70640904 unclassified probably benign
R9393:Gp1ba UTSW 11 70640467 missense unknown
X0025:Gp1ba UTSW 11 70640902 unclassified probably benign
Z1177:Gp1ba UTSW 11 70639407 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACAATGCGCCTGTCTACTCC -3'
(R):5'- TCAGGATGGTAGTAGTGGGCAC -3'

Sequencing Primer
(F):5'- TGTCTACTCCTACCCAGGGAAG -3'
(R):5'- CTGTGCTCTGGGGTAGTCAG -3'
Posted On 2022-02-07