Incidental Mutation 'R9164:Dock4'
ID 695937
Institutional Source Beutler Lab
Gene Symbol Dock4
Ensembl Gene ENSMUSG00000035954
Gene Name dedicator of cytokinesis 4
Synonyms EST N28122, 6330411N01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock # R9164 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 40445952-40846874 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 40704338 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 442 (I442N)
Ref Sequence ENSEMBL: ENSMUSP00000047387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037488] [ENSMUST00000220912]
AlphaFold P59764
Predicted Effect probably damaging
Transcript: ENSMUST00000037488
AA Change: I442N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047387
Gene: ENSMUSG00000035954
AA Change: I442N

DomainStartEndE-ValueType
SH3 9 66 7.29e-10 SMART
Pfam:DOCK_N 69 392 8.2e-110 PFAM
Pfam:DOCK-C2 397 583 1.9e-55 PFAM
low complexity region 829 842 N/A INTRINSIC
Pfam:DHR-2 1092 1596 5e-108 PFAM
low complexity region 1651 1664 N/A INTRINSIC
low complexity region 1681 1696 N/A INTRINSIC
low complexity region 1700 1713 N/A INTRINSIC
low complexity region 1842 1872 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1940 1950 N/A INTRINSIC
low complexity region 1958 1973 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000220912
AA Change: I442N

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the dedicator of cytokinesis (DOCK) family and encodes a protein with a DHR-1 (CZH-1) domain, a DHR-2 (CZH-2) domain and an SH3 domain. This membrane-associated, cytoplasmic protein functions as a guanine nucleotide exchange factor and is involved in regulation of adherens junctions between cells. Mutations in this gene have been associated with ovarian, prostate, glioma, and colorectal cancers. Alternatively spliced variants which encode different protein isoforms have been described, but only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. Heterozygotes display altered blood vessel lumen formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,328,157 E3112D probably damaging Het
Abtb2 C T 2: 103,711,484 T847I possibly damaging Het
Acox1 A T 11: 116,198,347 H48Q probably benign Het
Adam9 A G 8: 24,996,779 I161T possibly damaging Het
Ankrd50 A G 3: 38,457,055 Y388H probably damaging Het
Arap1 A T 7: 101,391,883 K593* probably null Het
Bicc1 G A 10: 70,945,264 T661M probably damaging Het
Cela1 A G 15: 100,682,885 probably null Het
Celf1 T A 2: 91,001,081 L85H probably damaging Het
Cep120 A T 18: 53,719,246 M520K probably benign Het
Chd1l C T 3: 97,594,040 R230H probably benign Het
Cyp2c55 A T 19: 39,007,127 K28* probably null Het
D930048N14Rik A T 11: 51,654,782 H167L unknown Het
Ddx58 T A 4: 40,208,827 M762L probably damaging Het
Dnah11 C T 12: 118,027,516 E2372K probably damaging Het
Dpp6 T C 5: 27,451,288 probably null Het
Dysf T C 6: 84,203,326 C1960R probably damaging Het
Gm13941 T C 2: 111,105,979 S2G unknown Het
Gm37240 T C 3: 84,509,941 N157S possibly damaging Het
Gp1ba A G 11: 70,640,457 I350V unknown Het
Gtf3c4 A G 2: 28,834,649 V357A probably benign Het
Hemgn T C 4: 46,396,106 I377V probably benign Het
Hsd3b3 T C 3: 98,753,373 D28G probably benign Het
Intu A T 3: 40,690,703 D508V probably damaging Het
Kif28 A T 1: 179,705,768 M604K probably damaging Het
Klra6 T A 6: 130,016,724 I195F possibly damaging Het
Lhfp G A 3: 53,043,466 V54I probably benign Het
Lrpap1 T C 5: 35,105,579 Y38C probably damaging Het
Maats1 A G 16: 38,335,598 Y88H possibly damaging Het
Map1b T A 13: 99,425,843 Q2453L unknown Het
Map1b C A 13: 99,432,308 E1302* probably null Het
Map7 C T 10: 20,246,664 R159C probably benign Het
Mov10l1 C T 15: 89,012,158 T735I probably benign Het
Nfasc C A 1: 132,634,806 R77L probably damaging Het
Nipsnap1 T C 11: 4,889,969 V230A probably benign Het
Olfr1206 C T 2: 88,865,451 P282L possibly damaging Het
Olfr857 T A 9: 19,713,658 M277K probably benign Het
Olfr860 T A 9: 19,846,208 N137I possibly damaging Het
Orm3 T C 4: 63,356,572 L39P probably damaging Het
Pcdhb19 T A 18: 37,498,799 V549E probably damaging Het
Pclo T A 5: 14,681,685 S274R Het
Phactr1 A G 13: 42,682,702 D2G possibly damaging Het
Phtf2 G A 5: 20,803,192 R164* probably null Het
Prkcq A G 2: 11,226,905 D13G probably damaging Het
Proser1 A T 3: 53,472,073 N156I probably benign Het
Prss51 T C 14: 64,097,509 I171T probably damaging Het
Ptbp2 G A 3: 119,752,991 P81S probably damaging Het
Ptk2b T C 14: 66,166,773 D681G possibly damaging Het
Slc7a12 A T 3: 14,499,300 I349F probably damaging Het
Sorcs2 G T 5: 36,077,968 T240K possibly damaging Het
Sowahc C A 10: 59,222,075 A11E probably benign Het
Spag1 A T 15: 36,216,253 Y526F probably damaging Het
Stim1 A G 7: 102,435,419 H526R probably benign Het
Stx1b T C 7: 127,814,987 K69R probably benign Het
Tal1 T C 4: 115,063,449 S107P probably benign Het
Tas2r130 T C 6: 131,630,012 I273M probably damaging Het
Ttc24 A T 3: 88,072,988 Y135* probably null Het
Ttn G A 2: 76,753,512 P22384S probably damaging Het
Vmn2r14 T G 5: 109,216,221 T610P probably damaging Het
Vmn2r84 T A 10: 130,385,800 *850C probably null Het
Vwf T A 6: 125,565,843 I94N Het
Zan A T 5: 137,424,071 S2762T unknown Het
Zbtb20 A G 16: 43,610,401 Q352R probably benign Het
Zfc3h1 T C 10: 115,423,469 Y1649H probably benign Het
Zfp397 A T 18: 23,956,771 Q111L probably damaging Het
Zfp616 T A 11: 74,084,999 I698N probably damaging Het
Other mutations in Dock4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dock4 APN 12 40832306 missense possibly damaging 0.48
IGL00726:Dock4 APN 12 40790068 splice site probably benign
IGL00790:Dock4 APN 12 40834391 missense probably damaging 1.00
IGL01061:Dock4 APN 12 40702969 missense probably benign 0.01
IGL01083:Dock4 APN 12 40788381 splice site probably benign
IGL01412:Dock4 APN 12 40730041 splice site probably benign
IGL01583:Dock4 APN 12 40810467 nonsense probably null
IGL01603:Dock4 APN 12 40693031 missense probably damaging 1.00
IGL01766:Dock4 APN 12 40446379 nonsense probably null
IGL02067:Dock4 APN 12 40834385 missense probably damaging 1.00
IGL02302:Dock4 APN 12 40725777 missense probably damaging 1.00
IGL02406:Dock4 APN 12 40777207 missense probably benign 0.01
IGL02547:Dock4 APN 12 40737479 missense probably benign
IGL02613:Dock4 APN 12 40810466 missense probably damaging 1.00
IGL02643:Dock4 APN 12 40668430 missense probably damaging 1.00
IGL02952:Dock4 APN 12 40710903 critical splice donor site probably null
IGL02994:Dock4 APN 12 40779160 missense probably damaging 0.99
IGL03096:Dock4 APN 12 40748001 missense probably benign 0.00
IGL03144:Dock4 APN 12 40692907 splice site probably benign
IGL03223:Dock4 APN 12 40817594 missense probably damaging 1.00
IGL03296:Dock4 APN 12 40733257 missense possibly damaging 0.84
IGL03349:Dock4 APN 12 40733310 missense probably benign 0.42
IGL03353:Dock4 APN 12 40817758 splice site probably null
BB005:Dock4 UTSW 12 40788303 missense probably damaging 0.98
BB015:Dock4 UTSW 12 40788303 missense probably damaging 0.98
R0046:Dock4 UTSW 12 40737360 splice site probably benign
R0046:Dock4 UTSW 12 40737360 splice site probably benign
R0110:Dock4 UTSW 12 40621312 splice site probably benign
R0238:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0238:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0239:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0239:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0472:Dock4 UTSW 12 40838438 intron probably benign
R0616:Dock4 UTSW 12 40704415 missense probably benign 0.31
R0647:Dock4 UTSW 12 40710884 missense probably damaging 1.00
R0706:Dock4 UTSW 12 40702923 missense probably damaging 0.98
R0791:Dock4 UTSW 12 40704481 missense probably damaging 1.00
R0940:Dock4 UTSW 12 40631627 splice site probably benign
R1087:Dock4 UTSW 12 40729938 missense probably benign 0.40
R1180:Dock4 UTSW 12 40640414 missense possibly damaging 0.52
R1194:Dock4 UTSW 12 40829616 missense probably damaging 1.00
R1463:Dock4 UTSW 12 40816325 frame shift probably null
R1468:Dock4 UTSW 12 40755810 missense probably benign 0.00
R1468:Dock4 UTSW 12 40755810 missense probably benign 0.00
R1523:Dock4 UTSW 12 40693025 missense possibly damaging 0.88
R1616:Dock4 UTSW 12 40669045 missense probably damaging 0.99
R1682:Dock4 UTSW 12 40725780 missense probably damaging 1.00
R1691:Dock4 UTSW 12 40725755 missense probably benign 0.26
R1693:Dock4 UTSW 12 40834722 missense probably benign 0.07
R1737:Dock4 UTSW 12 40807001 splice site probably null
R1802:Dock4 UTSW 12 40794598 missense possibly damaging 0.90
R1813:Dock4 UTSW 12 40636228 missense probably damaging 1.00
R1846:Dock4 UTSW 12 40733268 missense probably benign 0.00
R1959:Dock4 UTSW 12 40710798 missense probably damaging 1.00
R1975:Dock4 UTSW 12 40779642 splice site probably benign
R1986:Dock4 UTSW 12 40730063 missense probably damaging 1.00
R2105:Dock4 UTSW 12 40692989 missense probably benign 0.00
R2134:Dock4 UTSW 12 40745668 missense probably benign
R2135:Dock4 UTSW 12 40745668 missense probably benign
R2154:Dock4 UTSW 12 40820662 missense probably damaging 1.00
R2154:Dock4 UTSW 12 40844548 small insertion probably benign
R2864:Dock4 UTSW 12 40730073 missense probably damaging 1.00
R2890:Dock4 UTSW 12 40623801 critical splice acceptor site probably null
R3086:Dock4 UTSW 12 40731863 missense probably benign 0.02
R3808:Dock4 UTSW 12 40672810 missense probably damaging 0.99
R3811:Dock4 UTSW 12 40779124 missense possibly damaging 0.87
R3836:Dock4 UTSW 12 40794624 critical splice donor site probably null
R3838:Dock4 UTSW 12 40794624 critical splice donor site probably null
R4091:Dock4 UTSW 12 40844267 missense probably damaging 0.99
R4735:Dock4 UTSW 12 40631526 missense probably benign 0.31
R4752:Dock4 UTSW 12 40446365 missense probably benign 0.04
R4828:Dock4 UTSW 12 40668437 missense probably damaging 1.00
R5039:Dock4 UTSW 12 40817746 missense probably damaging 1.00
R5092:Dock4 UTSW 12 40844441 missense probably benign
R5146:Dock4 UTSW 12 40649492 splice site probably null
R5213:Dock4 UTSW 12 40676742 missense probably damaging 1.00
R5214:Dock4 UTSW 12 40704466 missense probably benign 0.00
R5270:Dock4 UTSW 12 40733271 missense probably benign 0.02
R5426:Dock4 UTSW 12 40745745 missense probably damaging 1.00
R5474:Dock4 UTSW 12 40745731 missense probably benign
R5544:Dock4 UTSW 12 40834702 missense possibly damaging 0.87
R5615:Dock4 UTSW 12 40649480 missense probably benign 0.22
R5649:Dock4 UTSW 12 40844540 missense probably benign 0.03
R5702:Dock4 UTSW 12 40737491 missense probably benign 0.02
R5846:Dock4 UTSW 12 40817736 missense probably damaging 1.00
R5847:Dock4 UTSW 12 40621251 missense probably damaging 0.97
R5895:Dock4 UTSW 12 40755813 missense probably damaging 1.00
R5997:Dock4 UTSW 12 40755834 missense probably damaging 0.99
R6011:Dock4 UTSW 12 40817757 critical splice donor site probably null
R6022:Dock4 UTSW 12 40748110 missense probably benign 0.04
R6038:Dock4 UTSW 12 40733351 splice site probably null
R6038:Dock4 UTSW 12 40733351 splice site probably null
R6179:Dock4 UTSW 12 40731869 missense probably benign 0.00
R6479:Dock4 UTSW 12 40828955 missense probably damaging 1.00
R6516:Dock4 UTSW 12 40731899 missense possibly damaging 0.94
R6748:Dock4 UTSW 12 40704466 missense probably benign 0.44
R6752:Dock4 UTSW 12 40820617 missense probably damaging 1.00
R6814:Dock4 UTSW 12 40812326 critical splice donor site probably null
R6864:Dock4 UTSW 12 40745746 missense probably damaging 1.00
R6872:Dock4 UTSW 12 40812326 critical splice donor site probably null
R6891:Dock4 UTSW 12 40779136 missense probably damaging 1.00
R6937:Dock4 UTSW 12 40834635 missense probably benign 0.01
R6950:Dock4 UTSW 12 40733314 missense possibly damaging 0.80
R7081:Dock4 UTSW 12 40621286 missense probably damaging 1.00
R7129:Dock4 UTSW 12 40828879 missense probably damaging 1.00
R7140:Dock4 UTSW 12 40636159 missense probably benign 0.06
R7241:Dock4 UTSW 12 40794860 missense probably damaging 1.00
R7378:Dock4 UTSW 12 40788244 missense possibly damaging 0.94
R7714:Dock4 UTSW 12 40725649 nonsense probably null
R7720:Dock4 UTSW 12 40806975 missense probably damaging 0.99
R7756:Dock4 UTSW 12 40710879 missense probably benign 0.02
R7758:Dock4 UTSW 12 40710879 missense probably benign 0.02
R7759:Dock4 UTSW 12 40817736 missense probably damaging 1.00
R7787:Dock4 UTSW 12 40725677 missense probably benign
R7879:Dock4 UTSW 12 40730084 missense possibly damaging 0.76
R7928:Dock4 UTSW 12 40788303 missense probably damaging 0.98
R8000:Dock4 UTSW 12 40833119 missense probably benign 0.05
R8042:Dock4 UTSW 12 40745760 missense probably benign 0.01
R8231:Dock4 UTSW 12 40702951 missense possibly damaging 0.88
R8234:Dock4 UTSW 12 40834838 splice site probably null
R8758:Dock4 UTSW 12 40788232 missense probably benign 0.12
R8871:Dock4 UTSW 12 40745731 missense probably benign
R8873:Dock4 UTSW 12 40676768 nonsense probably null
R8884:Dock4 UTSW 12 40806885 missense probably damaging 1.00
R9225:Dock4 UTSW 12 40829670 missense probably benign 0.02
R9276:Dock4 UTSW 12 40649405 missense possibly damaging 0.48
R9307:Dock4 UTSW 12 40636156 missense probably damaging 1.00
RF018:Dock4 UTSW 12 40844399 frame shift probably null
RF025:Dock4 UTSW 12 40844393 frame shift probably null
RF063:Dock4 UTSW 12 40844399 frame shift probably null
X0028:Dock4 UTSW 12 40669047 missense probably benign 0.25
Z1176:Dock4 UTSW 12 40631614 missense probably benign 0.01
Z1176:Dock4 UTSW 12 40631616 missense probably benign 0.16
Z1177:Dock4 UTSW 12 40817641 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATGGAAGAGCCTCCTGAGTG -3'
(R):5'- GCCCACAGTAAGTACAGGAC -3'

Sequencing Primer
(F):5'- GGAGTTGAATTCTTACATCACATCCC -3'
(R):5'- GTAAGTACAGGACTCACCCCAAG -3'
Posted On 2022-02-07