Mutagenetix > Incidental Mutation

Incidental Mutation 'R9164:Map1b'

695940

Institutional Source

Beutler Lab

Gene Symbol

Map1b

Ensembl Gene

ENSMUSG00000052727

Gene Name

microtubule-associated protein 1B

Synonyms

Mtap1b, MAP5, Mtap-5, Mtap5, LC1

MMRRC Submission

068944-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9164 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

99421446-99516540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 99425843 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 2453 (Q2453L)

Ref Sequence

ENSEMBL: ENSMUSP00000068374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064762]

AlphaFold

P14873

Predicted Effect

unknown
Transcript: ENSMUST00000064762
AA Change: Q2453L

SMART Domains

Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: Q2453L

Domain	Start	End	E-Value	Type
low complexity region	41	50	N/A	INTRINSIC
Blast:Lactamase_B	270	514	1e-56	BLAST
low complexity region	578	595	N/A	INTRINSIC
low complexity region	597	617	N/A	INTRINSIC
SCOP:d1gkub2	633	735	8e-4	SMART
low complexity region	771	813	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	889	913	N/A	INTRINSIC
low complexity region	935	956	N/A	INTRINSIC
low complexity region	1006	1030	N/A	INTRINSIC
low complexity region	1247	1261	N/A	INTRINSIC
low complexity region	1390	1404	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
low complexity region	1724	1735	N/A	INTRINSIC
Pfam:MAP1B_neuraxin	1891	1907	1.9e-10	PFAM
Pfam:MAP1B_neuraxin	1908	1924	8.3e-11	PFAM
Pfam:MAP1B_neuraxin	1942	1958	3.1e-9	PFAM
Pfam:MAP1B_neuraxin	1959	1975	6.2e-9	PFAM
Pfam:MAP1B_neuraxin	2027	2043	2.9e-10	PFAM
Pfam:MAP1B_neuraxin	2044	2060	3.9e-9	PFAM
low complexity region	2227	2257	N/A	INTRINSIC
low complexity region	2286	2307	N/A	INTRINSIC
low complexity region	2316	2343	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	C	11: 9,328,157	E3112D	probably damaging	Het
Abtb2	C	T	2: 103,711,484	T847I	possibly damaging	Het
Acox1	A	T	11: 116,198,347	H48Q	probably benign	Het
Adam9	A	G	8: 24,996,779	I161T	possibly damaging	Het
Ankrd50	A	G	3: 38,457,055	Y388H	probably damaging	Het
Arap1	A	T	7: 101,391,883	K593*	probably null	Het
Bicc1	G	A	10: 70,945,264	T661M	probably damaging	Het
Cela1	A	G	15: 100,682,885		probably null	Het
Celf1	T	A	2: 91,001,081	L85H	probably damaging	Het
Cep120	A	T	18: 53,719,246	M520K	probably benign	Het
Chd1l	C	T	3: 97,594,040	R230H	probably benign	Het
Cyp2c55	A	T	19: 39,007,127	K28*	probably null	Het
D930048N14Rik	A	T	11: 51,654,782	H167L	unknown	Het
Ddx58	T	A	4: 40,208,827	M762L	probably damaging	Het
Dnah11	C	T	12: 118,027,516	E2372K	probably damaging	Het
Dock4	T	A	12: 40,704,338	I442N	probably damaging	Het
Dpp6	T	C	5: 27,451,288		probably null	Het
Dysf	T	C	6: 84,203,326	C1960R	probably damaging	Het
Gm13941	T	C	2: 111,105,979	S2G	unknown	Het
Gm37240	T	C	3: 84,509,941	N157S	possibly damaging	Het
Gp1ba	A	G	11: 70,640,457	I350V	unknown	Het
Gtf3c4	A	G	2: 28,834,649	V357A	probably benign	Het
Hemgn	T	C	4: 46,396,106	I377V	probably benign	Het
Hsd3b3	T	C	3: 98,753,373	D28G	probably benign	Het
Intu	A	T	3: 40,690,703	D508V	probably damaging	Het
Kif28	A	T	1: 179,705,768	M604K	probably damaging	Het
Klra6	T	A	6: 130,016,724	I195F	possibly damaging	Het
Lhfp	G	A	3: 53,043,466	V54I	probably benign	Het
Lrpap1	T	C	5: 35,105,579	Y38C	probably damaging	Het
Maats1	A	G	16: 38,335,598	Y88H	possibly damaging	Het
Map7	C	T	10: 20,246,664	R159C	probably benign	Het
Mov10l1	C	T	15: 89,012,158	T735I	probably benign	Het
Nfasc	C	A	1: 132,634,806	R77L	probably damaging	Het
Nipsnap1	T	C	11: 4,889,969	V230A	probably benign	Het
Olfr1206	C	T	2: 88,865,451	P282L	possibly damaging	Het
Olfr857	T	A	9: 19,713,658	M277K	probably benign	Het
Olfr860	T	A	9: 19,846,208	N137I	possibly damaging	Het
Orm3	T	C	4: 63,356,572	L39P	probably damaging	Het
Pcdhb19	T	A	18: 37,498,799	V549E	probably damaging	Het
Pclo	T	A	5: 14,681,685	S274R		Het
Phactr1	A	G	13: 42,682,702	D2G	possibly damaging	Het
Phtf2	G	A	5: 20,803,192	R164*	probably null	Het
Prkcq	A	G	2: 11,226,905	D13G	probably damaging	Het
Proser1	A	T	3: 53,472,073	N156I	probably benign	Het
Prss51	T	C	14: 64,097,509	I171T	probably damaging	Het
Ptbp2	G	A	3: 119,752,991	P81S	probably damaging	Het
Ptk2b	T	C	14: 66,166,773	D681G	possibly damaging	Het
Slc7a12	A	T	3: 14,499,300	I349F	probably damaging	Het
Sorcs2	G	T	5: 36,077,968	T240K	possibly damaging	Het
Sowahc	C	A	10: 59,222,075	A11E	probably benign	Het
Spag1	A	T	15: 36,216,253	Y526F	probably damaging	Het
Stim1	A	G	7: 102,435,419	H526R	probably benign	Het
Stx1b	T	C	7: 127,814,987	K69R	probably benign	Het
Tal1	T	C	4: 115,063,449	S107P	probably benign	Het
Tas2r130	T	C	6: 131,630,012	I273M	probably damaging	Het
Ttc24	A	T	3: 88,072,988	Y135*	probably null	Het
Ttn	G	A	2: 76,753,512	P22384S	probably damaging	Het
Vmn2r14	T	G	5: 109,216,221	T610P	probably damaging	Het
Vmn2r84	T	A	10: 130,385,800	*850C	probably null	Het
Vwf	T	A	6: 125,565,843	I94N		Het
Zan	A	T	5: 137,424,071	S2762T	unknown	Het
Zbtb20	A	G	16: 43,610,401	Q352R	probably benign	Het
Zfc3h1	T	C	10: 115,423,469	Y1649H	probably benign	Het
Zfp397	A	T	18: 23,956,771	Q111L	probably damaging	Het
Zfp616	T	A	11: 74,084,999	I698N	probably damaging	Het

Other mutations in Map1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Map1b	APN	13	99429233	missense	unknown
IGL00533:Map1b	APN	13	99432604	missense	unknown
IGL00801:Map1b	APN	13	99430097	missense	unknown
IGL01141:Map1b	APN	13	99434761	missense	probably damaging	1.00
IGL01418:Map1b	APN	13	99431830	missense	unknown
IGL01464:Map1b	APN	13	99432743	missense	unknown
IGL01690:Map1b	APN	13	99435004	missense	probably damaging	1.00
IGL01991:Map1b	APN	13	99429569	missense	unknown
IGL02245:Map1b	APN	13	99431528	missense	unknown
IGL02376:Map1b	APN	13	99435595	missense	probably damaging	1.00
IGL02380:Map1b	APN	13	99431143	missense	unknown
IGL02442:Map1b	APN	13	99508198	missense	probably damaging	1.00
IGL02465:Map1b	APN	13	99433406	missense	unknown
IGL02816:Map1b	APN	13	99441755	missense	probably damaging	1.00
IGL02859:Map1b	APN	13	99433036	missense	unknown
IGL02934:Map1b	APN	13	99435131	missense	probably benign	0.09
IGL02970:Map1b	APN	13	99430734	nonsense	probably null
IGL03148:Map1b	APN	13	99441695	missense	probably damaging	1.00
IGL03401:Map1b	APN	13	99427268	missense	unknown
IGL03138:Map1b	UTSW	13	99425826	missense	unknown
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0035:Map1b	UTSW	13	99435338	missense	probably damaging	1.00
R0069:Map1b	UTSW	13	99429848	missense	unknown
R0315:Map1b	UTSW	13	99431116	missense	unknown
R0539:Map1b	UTSW	13	99434018	missense	unknown
R0548:Map1b	UTSW	13	99431683	missense	unknown
R0613:Map1b	UTSW	13	99441641	missense	probably damaging	1.00
R0730:Map1b	UTSW	13	99429766	nonsense	probably null
R1103:Map1b	UTSW	13	99427466	splice site	probably benign
R1300:Map1b	UTSW	13	99432521	missense	unknown
R1353:Map1b	UTSW	13	99427326	missense	unknown
R1387:Map1b	UTSW	13	99432650	missense	unknown
R1481:Map1b	UTSW	13	99431171	missense	unknown
R1509:Map1b	UTSW	13	99431528	missense	unknown
R1521:Map1b	UTSW	13	99432739	missense	unknown
R1604:Map1b	UTSW	13	99429572	missense	unknown
R1649:Map1b	UTSW	13	99516478	missense	probably benign	0.03
R1651:Map1b	UTSW	13	99432583	missense	unknown
R1661:Map1b	UTSW	13	99431929	missense	unknown
R1665:Map1b	UTSW	13	99431929	missense	unknown
R1770:Map1b	UTSW	13	99430493	missense	unknown
R1926:Map1b	UTSW	13	99430692	missense	unknown
R1928:Map1b	UTSW	13	99430946	missense	unknown
R2093:Map1b	UTSW	13	99429670	missense	unknown
R2110:Map1b	UTSW	13	99431121	missense	unknown
R2116:Map1b	UTSW	13	99430644	missense	unknown
R2164:Map1b	UTSW	13	99429338	missense	unknown
R2207:Map1b	UTSW	13	99431083	missense	unknown
R2273:Map1b	UTSW	13	99432084	missense	unknown
R2443:Map1b	UTSW	13	99430411	missense	unknown
R3054:Map1b	UTSW	13	99432742	missense	unknown
R3766:Map1b	UTSW	13	99434087	missense	unknown
R3911:Map1b	UTSW	13	99431072	missense	unknown
R4005:Map1b	UTSW	13	99429907	missense	unknown
R4130:Map1b	UTSW	13	99431680	missense	unknown
R4513:Map1b	UTSW	13	99444233	missense	probably damaging	1.00
R4613:Map1b	UTSW	13	99430302	nonsense	probably null
R4633:Map1b	UTSW	13	99434942	missense	probably damaging	1.00
R4646:Map1b	UTSW	13	99432469	missense	unknown
R4690:Map1b	UTSW	13	99431068	missense	unknown
R4704:Map1b	UTSW	13	99430475	missense	unknown
R4836:Map1b	UTSW	13	99431054	missense	unknown
R4916:Map1b	UTSW	13	99433300	missense	unknown
R4951:Map1b	UTSW	13	99432427	missense	unknown
R4960:Map1b	UTSW	13	99432212	missense	probably benign	0.23
R4961:Map1b	UTSW	13	99435653	missense	probably damaging	1.00
R5030:Map1b	UTSW	13	99434174	missense	unknown
R5090:Map1b	UTSW	13	99430026	nonsense	probably null
R5469:Map1b	UTSW	13	99429338	missense	unknown
R5820:Map1b	UTSW	13	99432824	missense	unknown
R5885:Map1b	UTSW	13	99430081	missense	unknown
R5915:Map1b	UTSW	13	99430331	missense	unknown
R5923:Map1b	UTSW	13	99433153	missense	unknown
R6063:Map1b	UTSW	13	99431137	missense	unknown
R6102:Map1b	UTSW	13	99425873	missense	unknown
R6218:Map1b	UTSW	13	99433206	missense	unknown
R6435:Map1b	UTSW	13	99516363	missense	probably damaging	0.99
R6663:Map1b	UTSW	13	99430022	missense	unknown
R6765:Map1b	UTSW	13	99425941	missense	unknown
R6860:Map1b	UTSW	13	99434767	missense	probably damaging	1.00
R6997:Map1b	UTSW	13	99430634	missense	unknown
R7001:Map1b	UTSW	13	99430593	missense	unknown
R7310:Map1b	UTSW	13	99433655	missense	unknown
R7349:Map1b	UTSW	13	99433640	missense	unknown
R7448:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7449:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7452:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7810:Map1b	UTSW	13	99431882	missense	unknown
R7820:Map1b	UTSW	13	99431177	missense	unknown
R8396:Map1b	UTSW	13	99434113	missense	unknown
R8470:Map1b	UTSW	13	99516442	missense	probably damaging	0.98
R8535:Map1b	UTSW	13	99435154	missense	probably damaging	1.00
R8777:Map1b	UTSW	13	99430796	missense	unknown
R8777-TAIL:Map1b	UTSW	13	99430796	missense	unknown
R8812:Map1b	UTSW	13	99432815	missense	unknown
R8903:Map1b	UTSW	13	99432509	nonsense	probably null
R8928:Map1b	UTSW	13	99432116	missense	unknown
R8954:Map1b	UTSW	13	99434227	missense	unknown
R9164:Map1b	UTSW	13	99432308	nonsense	probably null
R9190:Map1b	UTSW	13	99435406	missense	probably damaging	0.99
R9334:Map1b	UTSW	13	99431640	missense	unknown
R9339:Map1b	UTSW	13	99431062	missense	unknown
R9357:Map1b	UTSW	13	99430200	nonsense	probably null
R9430:Map1b	UTSW	13	99434108	missense	unknown
RF003:Map1b	UTSW	13	99430750	missense	unknown
X0019:Map1b	UTSW	13	99429968	missense	unknown
X0019:Map1b	UTSW	13	99432412	missense	unknown
Z1088:Map1b	UTSW	13	99508115	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- TGACTTGCATCACCATGACATAG -3'
(R):5'- CTGCTAGTGATCCAACAGACAC -3'

Sequencing Primer
(F):5'- CCATGACATAGTATAGCATCTGGC -3'
(R):5'- TAGTGATCCAACAGACACCTTGTTC -3'

Posted On

2022-02-07